Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Pistacia lentiscus seed lipase-producing endophyte PC1 and separation method thereof

A separation method and Pistacia chinensis technology are applied in the field of Pistacia chinensis seed lipase-producing endophyte PC1 and its separation, and can solve problems such as no Pistacia chinensis endophyte and the like.

Inactive Publication Date: 2015-03-04
HUNAN AGRICULTURAL UNIV
View PDF1 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

But so far there is no report about the endophytic bacteria of Pistacia chinensis

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Pistacia lentiscus seed lipase-producing endophyte PC1 and separation method thereof
  • Pistacia lentiscus seed lipase-producing endophyte PC1 and separation method thereof
  • Pistacia lentiscus seed lipase-producing endophyte PC1 and separation method thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0028] A lipase-producing endophyte PC1 from Pistacia chinensis seeds and a method for isolating the same, specifically through the following steps:

[0029] 1) Select fresh and healthy Pistacia chinensis fruit, physically remove the hard peel, pick out the undamaged seeds and soak them in at least 20 times the volume of 75% alcohol for 10 minutes, and soak them in 0.1% mercury chloride for 10 minutes, and shake them from time to time. Then wash with sterile water 5 times, each time for 1 min;

[0030] 2) Put 5 sterilized Pistacia chinensis seeds into a sterile mortar, add 500 μL of sterile water to grind into a paste, then add sterile water to dilute to 5 mL, take 100 μL of the diluted solution and inoculate it in beef extract peptone medium ( Beef extract 3g, NaCl 5g, peptone 10g, water 1L, PH 7.4~7.6), at the same time, take the sterile water and unground seeds washed for the last time as negative control, and cultivate them at 28°C for 3~7 days to obtain Endophytic bacter...

Embodiment 2

[0036] Embodiment 2 utilizes p-nitrophenol method to measure the enzymatic property of the lipase produced by PC1

[0037] 1. Determination of lipase activity by p-nitrophenol method

[0038] Solution A [30 mg p-nitrophenyl palmitate (p-NPP) dissolved in 10 mL isopropanol] and solution B [50 mmol / L Tris-HCl (pH 8.0)] were prepared respectively. Mix solutions A and B at a ratio of 1:18, take 1.9 mL into a test tube, add 0.1 mL of the supernatant crude enzyme solution (set the high-temperature inactivated crude enzyme solution as a negative control), and react at 28°C for 10 minutes. Add 1 mL of 10% SDS solution to terminate the reaction. The absorption value of the catalyzed p-nitrophenol (pNP) was measured at OD410nm with a spectrophotometer.

[0039] Definition of 1 enzyme activity unit of lipase: the amount of enzyme needed to release 1 μmol pNP per minute under the condition of pH 8.0 and 28°C, the enzyme activity calculation formula is:

[0040] A=([A l -A 0 ]×K+C 0 ...

Embodiment 3

[0045] Cloning of embodiment 3PC1 lipase gene

[0046] By using Clustalw software to perform multiple sequence alignment analysis on the nucleotide sequences of part of the Bacillus pumilus lipase published in the NCBI GenBank database, the strictly conserved segments were determined for the design of the forward and reverse directions of the full-length amplified lipase gene Primer (P 1 : TAG AGTCGTATAAGATGAATAAGG and P 2 : TTAATTCGTATTCTGTCCTCCG). PCR amplification system (50μL): Buffer 10μL, d NTP Mixture (2.5mM each) 4μL, (2.5U / μL)0.5μL, ddH203 2.5μL, primer P 1 and P 2 (10 μM) each 1 μL, PC1 genomic DNA 1 μL. PCR reaction conditions: pre-denaturation at 94°C for 4 min; denaturation at 95°C for 20 s, annealing at 58°C for 30 s, extension at 72°C for 1 min, a total of 30 cycles; extension at 72°C for 5 min. The amplified products were sent to the company for sequencing.

[0047] The results show that: the nucleotide full-length sequence of PC1 lipase is obtained b...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a pistacia lentiscus seed lipase-producing endophyte PC1 and a separation method thereof. The separation method comprises the following steps: treating seeds by using alcohol and mercury chloride, then inoculating the seeds to beef extract peptone, culturing to obtain an endophyte, fermenting strains by using liquid LB, inoculating a bacterial liquid to a glycerol tributyrate solid culture medium for culturing, selecting the strains with transparent zones, inoculating the strains to a liquid LB culture medium for fermentation, performing centrifugal separation and filtration on a fermentation liquid, culturing a filtrate by using the glycerol tributyrate solid culture medium, and screening to obtain the strain PC1. A single colony is obtained by performing plate streaking on the strain PC1, the single colony has a white appearance and a wet and smooth surface in an early growth stage, then wrinkles are generated in edges, and the surface becomes dry; and the strain is positive after being subjected to Gram staining, and a thallus is rod-shaped under the observation of an electron microscope.

Description

technical field [0001] The invention belongs to the field of biological technology, and in particular relates to endophytic bacteria PC1 producing lipase in Pistacia chinensis seeds and an isolation method thereof. Background technique [0002] Pistacia chinensis Bunge (Pistacia chinensis Bunge), also known as kaimu, neem, medicinal wood, etc., is a deciduous tree belonging to the genus Pistacia chinensis in the family Anacardiaceae. Pistacia chinensis seed contains 49.3% oil and 82.4% unsaturated fatty acid. It is an excellent wild oil resource, especially an ideal woody oil for biodiesel production. [0003] Plant endophytes (endophyte) refer to those fungi, bacteria or actinomycetes that live in various tissues and organs of healthy plants or in the intercellular space during a certain stage or all stages of their life history. Infected host plants (at least is temporary) showing no outward symptoms. Plant endophytes widely exist in all plants that have been studied, an...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N1/20C12R1/07
CPCC12N1/20C12N1/205C12R2001/07
Inventor 陈东红宋春竹阮颖黄勇刘春林
Owner HUNAN AGRICULTURAL UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com