Method for fixed-point introduction of non-natural amino acid to protein

An unnatural amino acid and protein technology, applied in biochemical equipment and methods, using vectors to introduce foreign genetic material, enzymes, etc., can solve the problems of long time consumption, environmental pollution, low yield, etc., and achieve high modification efficiency, The effect of less environmental pollution and high yield

Inactive Publication Date: 2015-03-25
武汉佰福泰制药有限公司
View PDF0 Cites 14 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The chemical synthesis method will inevitably encounter many problems in actual production and application, such as it takes a long time to explore the synthesis route, and the cost is high, the yield is low, and the environment is polluted.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for fixed-point introduction of non-natural amino acid to protein
  • Method for fixed-point introduction of non-natural amino acid to protein
  • Method for fixed-point introduction of non-natural amino acid to protein

Examples

Experimental program
Comparison scheme
Effect test

preparation example Construction

[0030] On the one hand, the present invention relates to a kind of Ne-butynyloxycarbyl-lysine chemical synthesis method, generates 3-alkyne-1-butanol chloroformate by activating 3-alkyne-1-butanol, and then React with Nα-protected lysine, and finally deprotect to obtain Ne-butynyloxycarbyl-lysine.

[0031] In another aspect, the present invention relates to a DNA sequence encoding recombinant wild-type lysyl synthetase;

[0032] In one embodiment, the DNA sequence encoding recombinant wild-type lysyl synthetase of the present invention is SEQ ID NO: 1:

[0033]ATGCCATAGCATTTTTATCCATAAGATTAGCGGATCCTACCTGACGCTTTTTATCGCAACTCTCTACTGTTTCTCCATACCCGTTTTTTTGGGCTAACAGGAGGAATTAGATCTATGGATAAAAAACCACTAAACACTCTGATATCTGCAACCGGGCTCTGGATGTCCAGGACCGGAACAATTCATAAAATAAAACACCACGAAGTCTCTCGAAGCAAAATCTATATTGAAATGGCATGCGGAGACCACCTTGTTGTAAACAACTCCAGGAGCAGCAGGACTGCAAGAGCGCTCAGGCACCACAAATACAGGAAGACCTGCAAACGCTGCAGGGTTTCGGATGAGGATCTCAATAAGTTCCTCACAAAGGCAAACGAAGACCAGACAAGCGTAAAAGTCAAGGTCGTTTCTGCCCCTACCAGAA...

Embodiment 1

[0047] Ne-butyneoxycarbyl-lysine chemical synthesis pathway

[0048] Synthetic routes such as figure 2 As indicated, the specific description is as follows:

[0049] Dissolve triphosgene (29.7 g, 100 mmol) in 200 ml of ether, add 0.5 g of activated carbon, and stir at room temperature for 1 hour. After the phosgene is completely decomposed, cool down to 0° C., and carefully add 3-alkyne-1-butanol ( figure 2 Compound 1, 14.0g, 200mmol). After the addition was complete, continue to stir and react for 16 hours. After TLC (PE:EA=4:1, Rf=0.6) could not detect 3-alkyne-1-butanol, the activated carbon was filtered off, and the residue was colorless after spin-drying the solvent at low temperature. Oily 3-alkyne-1-butanol chloroformate ( figure 2 Compound 2 in , 26 g), with a yield greater than 90%, was used for the next reaction without purification.

[0050] Dissolve sodium hydroxide ((8g, 200mmol) in 400ml water, then add sodium bicarbonate (67.2g, 800mmol), and stir until c...

Embodiment 2

[0055] Mutation treatment of target protein gene

[0056]Using the method of site-directed mutagenesis known to those skilled in the art, the base sequence of the site of the target protein to be introduced with unnatural amino acid is replaced with the primer of TAG, and the triplet of the site of the target protein that needs to be introduced with unnatural amino acid is made by PCR. The body base sequence is mutated to TAG. In the inventor's practice, the inventor selected hPTH (1-34) with superfolder green fluorescent protein (sfGFP) as a fusion tag and GLP-1 (6-36) with sfGFP as a fusion tag as target protein. Among them, the DNA sequences corresponding to the 18th, 22nd and 26th amino acids of hPTH (1-34) were mutated into TAG respectively; the DNA sequences corresponding to the 20th, 21st and 22nd amino acids of GLP-1 (6-36) were mutated into TAG respectively .

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a method for fixed-point introduction of non-natural amino acid to protein. More specifically, the invention discloses a method for specifically guiding a non-natural amino acid Ne-butineoxycarbonyl-lysine site into expected protein. The invention also provides a system for fixed-point introduction of non-natural amino acid Ne-butineoxycarbonyl to genetic coding expression of protein. The system comprises a DNA for expressing a wild pyrrole lysyl-tRNA synthetase, a homologous related tRNA and a gene sequence of which the site needing introduction of the non-natural amino acid Ne-butineoxycarbonyl-lysine is mutated into TAG.

Description

technical field [0001] The invention relates to the technical field of biomedical engineering. More specifically, the present invention relates to the field of translational biochemistry. Background technique [0002] As an important site of protein post-translational modification and a key residue in the active center of various enzymes, lysine plays an important role in the process of various proteins exercising their physiological and pathological functions. For proteins, especially polypeptide drugs, the appropriate modification of lysine residues may not only enhance the efficacy of polypeptide drugs and reduce drug toxicity, but also greatly reduce the immunogenicity of polypeptide drugs due to the incorporation of unnatural amino acids. Immunological rejection, and some proteases may no longer recognize polypeptide drugs mixed with unnatural amino acids, so that the drug can be maintained in the body for a longer period of time without being degraded, thereby prolong...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N15/52C12N15/70C12N9/00C12P21/02
Inventor万为
Owner武汉佰福泰制药有限公司