Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Method of producing L-alanyl-L-glutamine from recombinant escherichia coli

A technology for recombining Escherichia coli and glutamine, applied in the field of microbial genetic engineering, can solve the problems of low yield and high cost of L-alanyl-L-glutamine, and achieve the effects of enhanced system activity and important industrial application value

Inactive Publication Date: 2015-04-01
JIANGNAN UNIV
View PDF1 Cites 10 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] Obtaining L-alanyl-L-glutamine by the current biotransformation method has high cost and low yield, and the problem to be solved in the present invention is to provide a kind of L-alanyl-L-glutamine containing recombinant DNA. Method for enhancing activity of aminoamide biosynthesis system

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method of producing L-alanyl-L-glutamine from recombinant escherichia coli
  • Method of producing L-alanyl-L-glutamine from recombinant escherichia coli
  • Method of producing L-alanyl-L-glutamine from recombinant escherichia coli

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0030] Embodiment 1: the design of amino acid ester acyltransferase gene sequence

[0031] According to the codon usage frequency of Escherichia coli to optimize gene codons, eliminate codons with low usage rate, and use the synonymous transformation method to eliminate the EcoRI restriction site, in order to facilitate the connection of the amino acid ester acyltransferase gene to other plasmid vectors , so a restriction site BamH Ⅰ (GGATCC) was inserted behind the terminator.

[0032] Considering the secondary structure of mRNA, it is first necessary to ensure that the codon translation pocket consisting of the AUG start codon and several bases after it is open, reducing the energy potential of ribosomes binding to mRNA, so that ribosomes can smoothly Translate backwards along the start codon.

[0033] For the original sequence of the amino acid ester acyltransferase gene sequence in this embodiment, see Genbank ACCESSIONAB610978, and for the optimized amino acid ester acyl...

Embodiment 2

[0034] Example 2: Design of a phosphate promoter

[0035] The phosphate promoter is derived from the pEAM330 plasmid, and the plasmid map is attached to the instruction manual figure 1, the phosphate promoter of the plasmid is derived from the phosphate operon of the E. coli K12 strain, which is a weak promoter suitable for a large amount of accumulation of microbial cells. In order to facilitate the connection of the phosphate promoter and amino acid ester acyltransferase to the plasmid vector An EcoR 1 restriction site (GAATTC) was inserted upstream of the promoter, and the phosphate promoter sequence is shown in SEQ ID NO:2.

[0036] The amino acid ester acyltransferase gene sequence optimized in Example 1 and the phosphate promoter in Example 2 were directly connected together and submitted to Shanghai Xuguan Company for artificial synthesis and connected to the vector pUC19 to obtain the plasmid pUC19-phoC- SAET, the plasmid map is attached to the instructions figure 2...

Embodiment 3

[0037] Embodiment 3: Construction of amino acid ester acyltransferase gene expression vector

[0038] Using the plasmid pUC19-phoC-SAET as a template, using primers

[0039] CAGAAGCTTATGAAAAACACTATAAGCT and

[0040] CGAGGATCCTTAGTCTTTCAGAACAGAA, for PCR amplification. A DNA fragment with a length of about 1800bp was obtained, and the electrophoresis of the PCR product was as follows image 3 shown.

[0041] (1) Construction of JM109 / pUC19-phoC-SAET

[0042] The plasmid pUC19-phoC-SAET synthesized in Example 1 and 2 was transformed into Escherichia coli JM109 competent cells. The transformation process is as follows: add 3 μL of connection solution to 50 μL of JM109 competent cells, then add 10 μL of 5×KCM buffer, mix well, place on ice for 30 minutes, heat shock at 42°C for 90 seconds, and then place on ice After standing for 5 minutes, add 500 μL of LB medium, incubate at 37°C, 220 rpm for 60 minutes, spread it on the Amp resistance plate, and incubate for 12 hours, pick...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a method of producing L-alanyl-L-glutamine from recombinant escherichia coli, wherein the method of producing L-alanyl-L-glutamine from recombinant escherichia coli is follows: in an aqueous solution with a determined pH value, acting on free L-glutamine and L-alanine methyl ester hydrochloride to generate L-alanyl-L-glutamine, recombining a gene segment of the protein with the amino-acid ester acyltransferase of the L-alanyl-L-glutamine into a carrier and transferring into host bacteria, thereby obtaining the host bacteria with the recombinant DNA and capable of strengthening the activity of an L-alanyl-L-glutamine biological synthesis system. The method comprises the following steps: (1) culturing a larger number of recombinant escherichia coli cells for expressing the amino-acid ester acyltransferase; (2) excessively expressing the amino-acid ester acyltransferase in the step (1); and (3) taking the amino-acid ester acyltransferase in the step (2) as a crude enzyme source, adding the crude enzyme source into a buffer solution containing L-glutamine and L-alanine methyl ester hydrochloride substrate amino acid to react, thereby realizing efficient production of the L-alanyl-L-glutamine.

Description

technical field [0001] The invention discloses a method for producing L-alanyl-L-glutamine by using recombinant Escherichia coli, which belongs to the field of microbial genetic engineering. Background technique [0002] Glutamine (Gln), as a special immune nutrient, has become a research hotspot in various fields, especially in the stressful state of the body, it is irreplaceable for maintaining the integrity of immune function and maintaining intestinal structure. Therefore, glutamine is considered to be a "conditionally essential amino acid" under stress. However, glutamine has poor water solubility (36g / L), insufficient chemical stability in aqueous solution, thermal disinfection and long-term storage, and will generate toxic pyroglutamic acid and ammonia under heat sterilization conditions, and contains L-glutamine The small peptide of amide has high thermal stability and water solubility, which makes up for the deficiency of L-glutamine and expands its clinical applic...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12P21/02C12R1/19
Inventor 张震宇何艳春夏紫薇王宇婷
Owner JIANGNAN UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com