A kind of pharmaceutical composition containing lncrna and its application
A composition and drug technology, applied in the field of pharmaceutical compositions containing LncRNA, can solve the problems of reduced sensitivity of anti-tumor drugs, abnormal regulation of apoptosis process, and treatment failure, etc., achieving environmentally friendly use, wide application range, and obvious curative effect Effect
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0027] Detection of expression levels of lncRNA in Hela cells, A549 cells and SGC7901 cells treated with doxorubicin, Hela cells, A549 cells and SGC7901 cells were treated with doxorubicin for 0h, 1h, 3h, 6h, 12h, and 24h, and the cells were collected. Total RNA was extracted by Trizol, and the expression level of lncRNA was detected by real-time fluorescent quantitative PCR method, and the expression changes of lncRNA were observed during the treatment of Hela cells, A549 cells and SGC7901 cells with adriamycin. The results showed that with the increase of doxorubicin treatment time of Hela cells, the expression level of lncRNA showed a trend of obvious increase; but after doxorubicin treatment of A549 cells and SGC7901 cells, the expression level of lncRNA did not change significantly, as shown in the attached figure 1 .
Embodiment 2
[0029]lncRNA and negative control adenovirus were constructed. In this example, the human genome was used as a template, and the lncRNA sequence was amplified by PCR. The subcloning was connected into the pSilencer Adeno 1.0-CMV system of Ambion Company to construct lncRNA overexpression adenovirus.
[0030] Its LncRNA nucleotide sequence is shown in the following SEQ ID NO:1:
[0031] SEQ ID NO: 1:
[0032] UUACAAGUGAACUUUCUUUCCUGUUUUAAAGCCUUUUAAAUAAACUUCCACUCCUGUGCUGAAACUUGCCUUAGUCUUUUUUUCUGCUUUAUGCCCCUCAGUCGAAUUCUUUCAUCUGAGGAGGCAAGAAUUGAAGUUGCUGCAGACGCCUGUGGAUUCACCACAAGUACAUUGGAGUAACCACUGGGAACAACAGGUUGCCUUAGAAGCUUUGCAGGUUGUUUUGUUUUUUUGUUUGUUUGUUUUUUUGAGACGGGGUCUCACUUUGUCGCCCAGGUUUGUUGCCCAGGCUGGAGUGCAGUGGCGCAAUCUCGGCUCUCCGCAACCUCUGCCUCCCGGGCUCAAGUGAUCCUCCCACCUCGGCUUCCCGAGUACCUGGGACUACAGGCAUGCACCACCACACCCGGCUAAUUUUAAUUUUUAUUUUGUAUUUUUAGUAGAGUUGGGGUUUCACCAUGUUCCCAGCUGGUCUUGAACUCUUGAGGUGAAGCAAUCCGCCCACCUCAGCCUCCCAAAGUGCUGAGAUUACAGACGUGAGCCAUCGCGCCUAGCCUUGCAAGUUGUUUUUUGUUGAACAGAA...
Embodiment 3
[0039] The pro-apoptotic function of lncRNA in Hela cells. In this example, lncRNA adenovirus (50PFU number / cell) was used to infect Hela cells, and the negative control adenovirus was used as a control. After 24 hours, it was treated with low concentration of doxorubicin for 24 hours After trypsinization, the cells were collected, stained with trypan blue and counted, and the effect of lncRNA on the apoptosis of Hela cells treated with low concentration of doxorubicin was calculated. It was observed that Hela cells overexpressing lncRNA significantly enhanced the resistance to low concentration of doxorubicin. hormone sensitivity, see appendix figure 2 .
PUM

Abstract
Description
Claims
Application Information

- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com