Unlock instant, AI-driven research and patent intelligence for your innovation.

A kind of pharmaceutical composition containing lncrna and its application

A composition and drug technology, applied in the field of pharmaceutical compositions containing LncRNA, can solve the problems of reduced sensitivity of anti-tumor drugs, abnormal regulation of apoptosis process, and treatment failure, etc., achieving environmentally friendly use, wide application range, and obvious curative effect Effect

Active Publication Date: 2018-04-06
QINGDAO UNIV
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the abnormal regulation of cell apoptosis can inhibit the apoptosis induced by chemotherapeutic drugs and lead to drug resistance.
The formation of drug resistance after treatment leads to a decrease in the sensitivity of antitumor drugs, which leads to the failure of treatment. Therefore, the problem of drug resistance of chemotherapy drugs in the treatment of tumors has become a major problem in current clinical treatment.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A kind of pharmaceutical composition containing lncrna and its application
  • A kind of pharmaceutical composition containing lncrna and its application
  • A kind of pharmaceutical composition containing lncrna and its application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0027] Detection of expression levels of lncRNA in Hela cells, A549 cells and SGC7901 cells treated with doxorubicin, Hela cells, A549 cells and SGC7901 cells were treated with doxorubicin for 0h, 1h, 3h, 6h, 12h, and 24h, and the cells were collected. Total RNA was extracted by Trizol, and the expression level of lncRNA was detected by real-time fluorescent quantitative PCR method, and the expression changes of lncRNA were observed during the treatment of Hela cells, A549 cells and SGC7901 cells with adriamycin. The results showed that with the increase of doxorubicin treatment time of Hela cells, the expression level of lncRNA showed a trend of obvious increase; but after doxorubicin treatment of A549 cells and SGC7901 cells, the expression level of lncRNA did not change significantly, as shown in the attached figure 1 .

Embodiment 2

[0029]lncRNA and negative control adenovirus were constructed. In this example, the human genome was used as a template, and the lncRNA sequence was amplified by PCR. The subcloning was connected into the pSilencer Adeno 1.0-CMV system of Ambion Company to construct lncRNA overexpression adenovirus.

[0030] Its LncRNA nucleotide sequence is shown in the following SEQ ID NO:1:

[0031] SEQ ID NO: 1:

[0032] UUACAAGUGAACUUUCUUUCCUGUUUUAAAGCCUUUUAAAUAAACUUCCACUCCUGUGCUGAAACUUGCCUUAGUCUUUUUUUCUGCUUUAUGCCCCUCAGUCGAAUUCUUUCAUCUGAGGAGGCAAGAAUUGAAGUUGCUGCAGACGCCUGUGGAUUCACCACAAGUACAUUGGAGUAACCACUGGGAACAACAGGUUGCCUUAGAAGCUUUGCAGGUUGUUUUGUUUUUUUGUUUGUUUGUUUUUUUGAGACGGGGUCUCACUUUGUCGCCCAGGUUUGUUGCCCAGGCUGGAGUGCAGUGGCGCAAUCUCGGCUCUCCGCAACCUCUGCCUCCCGGGCUCAAGUGAUCCUCCCACCUCGGCUUCCCGAGUACCUGGGACUACAGGCAUGCACCACCACACCCGGCUAAUUUUAAUUUUUAUUUUGUAUUUUUAGUAGAGUUGGGGUUUCACCAUGUUCCCAGCUGGUCUUGAACUCUUGAGGUGAAGCAAUCCGCCCACCUCAGCCUCCCAAAGUGCUGAGAUUACAGACGUGAGCCAUCGCGCCUAGCCUUGCAAGUUGUUUUUUGUUGAACAGAA...

Embodiment 3

[0039] The pro-apoptotic function of lncRNA in Hela cells. In this example, lncRNA adenovirus (50PFU number / cell) was used to infect Hela cells, and the negative control adenovirus was used as a control. After 24 hours, it was treated with low concentration of doxorubicin for 24 hours After trypsinization, the cells were collected, stained with trypan blue and counted, and the effect of lncRNA on the apoptosis of Hela cells treated with low concentration of doxorubicin was calculated. It was observed that Hela cells overexpressing lncRNA significantly enhanced the resistance to low concentration of doxorubicin. hormone sensitivity, see appendix figure 2 .

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a pharmaceutical composition containing LncRNA and a use thereof. The pharmaceutical composition is an LncRNA recombinant virus vector or a recombinant plasma vector comprising a water-soluble filling agent, a pH regulator, a stabilizer, injection water and an osmotic pressure regulator. A preparation method for the recombinant virus comprises the following steps: by taking a human genome as a template, performing PCR (polymerase chain reaction) amplification to obtain an LncRNA sequence, subcloning and connecting the LncRNA sequence to an adenovirus vector system to construct an LncRNA adenovirus. The pharmaceutical composition is used for preventing and treating tumors, and promoting tumor cell apoptosis or lowering tumor-forming ability of the tumor cells. The raw materials are easily available, safe and reliable; the prepared pharmaceutical composition is reasonable in component, obvious in curative effect and wide in scope of application.

Description

Technical field: [0001] The invention belongs to the field of medical biotechnology, and relates to a new drug of endogenous long-chain non-coding RNA and its application, in particular to a pharmaceutical composition containing LncRNA and its application. Background technique: [0002] At present, tumor is a major killer that endangers human health and life. There are about 14 million tumor patients in the world. In my country, the annual incidence is about 2 million, and the death toll is 1.4-1.5 million. It has surpassed cardiovascular and cerebrovascular diseases to become the number one killer threatening human health. The commonly used tumor chemotherapy and radiotherapy achieve the purpose of treating tumor by inducing tumor cell apoptosis. Apoptosis, also known as programmed cell death, is a process in which cells follow their own procedures and undergo genetic regulation under the induction of specific endogenous and exogenous signals. It plays an important role in...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): A61K48/00A61P35/00
Inventor 王昆李培峰
Owner QINGDAO UNIV
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More