Recombinant escherichia coli for preparing (S)-4-chlorine-3-hydroxyl ethyl butyrate by adopting asymmetric transformation and application of recombinant escherichia coli

A technology of recombinant Escherichia coli and ethyl hydroxybutyrate, applied in the field of enzyme catalysis, can solve the problems of large pollution, low yield, high energy consumption, etc.

Inactive Publication Date: 2015-05-27
EAST CHINA UNIV OF SCI & TECH
View PDF2 Cites 15 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0006] The purpose of the present invention is to provide a kind of recombinant escherichia coli and its application of asymmetric transformation preparation (S)-4-chloro-3-hydroxybutyrate ethyl ester, thereby solving the low yield of chemical method catalyzed product in the prior art , high energy consumption, high pollution, low yield of microbial catalytic products, low optical purity, and the need to add additional coenzyme defects

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Recombinant escherichia coli for preparing (S)-4-chlorine-3-hydroxyl ethyl butyrate by adopting asymmetric transformation and application of recombinant escherichia coli
  • Recombinant escherichia coli for preparing (S)-4-chlorine-3-hydroxyl ethyl butyrate by adopting asymmetric transformation and application of recombinant escherichia coli
  • Recombinant escherichia coli for preparing (S)-4-chlorine-3-hydroxyl ethyl butyrate by adopting asymmetric transformation and application of recombinant escherichia coli

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0027] Embodiment 1: Construction of recombinant escherichia coli

[0028] 1. Acquisition of carbonyl reductase gene:

[0029] Cyanobacteria Synechocystis sp.PCC 6803 (purchased from Pasteur Culture Collection of Cyanobacteria), medium Zobell 2216E (g L -1 ): peptone 5g, yeast extract 1g, ferric phosphate 0.1g, aged sea water 1000mL, pH 7.6.

[0030] The cyanobacteria Synechocystis sp.PCC 6803 was inoculated in 4 mL of Zobell 2216E liquid medium at 25°C to the logarithmic growth phase, and the genome was extracted using a genomic DNA extraction kit (Bacterial Genome Extraction Kit from Shanghai Jierui Company).

[0031] The primers used to construct the expression vectors are provided with enzyme cutting sites, and the primer sequences are as follows:

[0032]The upstream primer (SrCR-F contains Bam HI) is: AACGCGGATCCATGTTAAGTCTT GGTTTGGAAG, the downstream primer (SrCR-R contains HindⅢ) is: AACCCAAAGCTTAGGTGTGGTGGGCCCCATTT, and all primers are synthesized by Shanghai Jierui...

Embodiment 2

[0045] Example 2: Obtaining whole cells of recombinant Escherichia coli E.coli (pET28a-SrCR-GDH)

[0046] The transformants obtained in Example 1 were inoculated into LB liquid medium containing 50 μg / ml kanamycin resistance, cultured at 37° C. for 12 h, and then inoculated into fresh containing In 50ug / ml kanamycin-resistant LB liquid medium, culture at 37°C until the cell concentration OD600 is about 0.5, then add IPTG with a final concentration of 0.1mM to the LB liquid medium, and induce culture at 20°C for 20 hours, Centrifuge the culture solution at 4°C and 5000rpm for 6min, discard the supernatant, and collect the precipitate, which is the recombinant Escherichia coli (pET28a-SrCR-GDH) wet bacteria. Freeze-dried cells were obtained after the wet cells were freeze-dried for 4 hours. Centrifuge the precipitate after breaking the wet bacteria, take the supernatant and purify it with a nickel column, elute the impurity protein under 20mM imidazole, and elute the target pr...

Embodiment 3

[0047] Example 3: Application of the recombinant Escherichia coli in the preparation of (S)-CHBE

[0048] The freeze-dried thallus obtained in Example 2 was used as a catalyst. Weigh 0.5g freeze-dried bacteria and suspend in 25mL Trish-Hcl (100mM), add glucose 35mM, COBE 20mM, NADP 0.2mM, 30°C, react for 10min, the final substrate conversion rate reaches 100%, and the product optical purity e.e % is 99.4%.

[0049] The freeze-dried thallus obtained in Example 2 was used as a catalyst. Weigh 0.5g freeze-dried bacteria and suspend in 25mL Trish-Hcl (100mM), add glucose 600mM, COBE 400mM, NADP 0.2mM, 30℃, after 30min, the conversion rate of the final substrate reaches 100%, and the optical purity of the product is e.e. % is 99.3%.

[0050] The freeze-dried thallus obtained in Example 2 was used as a catalyst. Weigh 0.5g freeze-dried bacteria and suspend in 25mL Trish-Hcl (100mM), add glucose 900mM, COBE 600mM, NADP0.2mM, 30℃, after 1h reaction, the final substrate conversion ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a recombinant escherichia coli for preparing (S)-4-chlorine-3-hydroxyl ethyl butyrate by adopting asymmetric transformation and an application of the recombinant escherichia coli. The recombinant escherichia coli simultaneously comprises a carbonyl reductase gene and a glucose dehydrogenase gene; the sequences of the carbonyl reductase gene and the glucose dehydrogenase gene are respectively shown in SEQ ID NO.1 and SEQ ID NO.3. The recombinant escherichia coli provided by the invention can be applied to high-activity and high-selectivity catalysis of COBE to generate (S)-CHBE; the enzyme activity can be up to 33.1U / mg, and reaches the highest level reported in the literature; substrate and product inhibition are removed in situ by virtue of macroreticular resin, so that the accumulation of the final product (S)-CHBE can reach 3,000mM; the transformation rate of the final substrate can be up to 100%; the optical purity e.e% of the product cam reach 99.4%; and compared with the prior art, the optical purity is significantly improved.

Description

technical field [0001] The invention belongs to the field of enzyme catalysis, and more specifically relates to a recombinant Escherichia coli for preparing (S)-4-chloro-3-hydroxybutyric acid ethyl ester through asymmetric transformation and application thereof. Background technique [0002] Optically pure (S)-4-chloro-3-hydroxybutyrate ethyl ester (Ethyl 4-chloro-3-hydroxyrate, (S)-CHBE) is an important organic intermediate, and its main use is as Synthesis of precursor compounds of the cholesterol-lowering drug atorvastatin. Its chiral single enantiomer (S)-4-chloro-3-hydroxybutyrate ethyl ester ((S)-CHBE) can also be used in the synthesis of many other active drugs, such as hydroxymethylglutaryl CoA (HMG- CoA) reductase inhibitors and 1,4-dihydropyridine β-blockers, etc. [0003] The latent chiral substance 4-chloroacetoacetate (Ethyl 4-chloro-3-oxobutanoate, COBE) has the advantages of easy synthesis and low price. Using it as a reaction substrate for asymmetric reduct...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N1/21C12N15/70C12P7/62C12R1/19
CPCC12N9/0006C12P7/62C12Y101/01184C12Y101/9901
Inventor王华磊陈利锋魏东芝
OwnerEAST CHINA UNIV OF SCI & TECH