Unlock instant, AI-driven research and patent intelligence for your innovation.

Bacteriophage lysin with improved antibacterial effect

A lysozyme and mutant technology, applied in the field of biomedicine, can solve problems such as speeding up removal

Inactive Publication Date: 2015-06-24
QINGDAO AGRI UNIV
View PDF1 Cites 7 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

In addition, the lyase may be degraded and inactivated by hydrolytic enzymes in the body, which also speeds up its clearance in the body, and has become a problem that needs to be solved before the lyase is widely used in clinical practice.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Bacteriophage lysin with improved antibacterial effect
  • Bacteriophage lysin with improved antibacterial effect
  • Bacteriophage lysin with improved antibacterial effect

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0020] Example 1: Prokaryotic expression of phage lyase Bp7e mutant

[0021] 1.1 Materials

[0022] Phage lyase Bp7e protein expression plasmid pET28a-Bp7e, Escherichia coli BL21 strain were preserved by Microbiology Laboratory, College of Animal Science and Technology, Qingdao Agricultural University;

[0023] 1.2 Method

[0024] 1.2.1 First-round mutation reaction of amino acids of phage lyase Bp7e

[0025] 1.2.1.1 Design primers for the mutation site of the target gene

[0026] Site-directed mutations were performed on the amino acids of Bp7e (SEQ ID No: 1), so that the 99th position of leucine was mutated into alanine, and the 102nd position of methionine was mutated into glutamic acid. According to the primer design principle of the site-directed mutagenesis kit, two pairs of primers were designed, and the primers were synthesized by Shanghai Bioengineering Technology Service Co., Ltd.

[0027] Primer one upstream: 5'AAGTTCGTCGTTGTGCTGCAATTAACATGGTCTTC3'

[0028] Pri...

Embodiment 2

[0046] Example 2: Detection of antibacterial activity of phage lyase Bp7e and mutant proteins thereof

[0047] 1 Materials and methods

[0048] 1.1 Materials

[0049] Micrococcus lyticus, Escherichia coli, Salmonella, Staphylococcus aureus, Escherichia coli of 01, 015, 024, 078, 088 serotypes are preserved by our laboratory.

[0050] 1.2 Method

[0051] 1.2.1 Purification of phage lyase Bp7e and its mutant proteins

[0052] (1) Assemble the chromatographic column: Mix 1mL filler and add it to the chromatographic column, and let it stand at room temperature for 10 minutes. After the layers are separated, open the liquid outlet at the bottom to let the ethanol flow out slowly by gravity.

[0053] (2) Pick a single colony from the strains expressing the lyase Bp7e and its mutants, and inoculate them in 5 mL of LB liquid culture containing Kana, and cultivate overnight at 37°C with shaking.

[0054] (3) The next day, take out 2.5mL and add 250mL LB liquid culture containing Ka...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a bacteriophage lysin with animproved antibacterial effect. The 99th leucine and the 102nd methionine of lyase Bp7e amino acid are respectively mutated to obtain alanine and glutamic acid, by using a prokaryotic expression technique, mutant protein can be obtained, and the mutant protein is identified by using Western-blot and is named Bp7c mutant protein. Bp7e and Bp7e mutant protein are purified, the concentration of Bp7e and Bp7e mutant protein is detected, and the in-vitro pyrolysis experiment and the pyrolysis spectrum detection show that purified Bp7e and Bp7e mutant protein have a broad-spectrum antibacterial function and have pyrolysis effects on micrococcus lysodeikticus, staphylococcus aureus, salmonellae and multiple serotype escherichia colis, and the pyrolysis effect of the Bp7e mutant protein is wholly superior to that of natural lyase Bp7e.

Description

technical field [0001] The invention relates to the technical field of biomedicine, in particular to a method for preparing a phage lyase with enhanced antibacterial effect through site-directed mutation and the obtained mutant phage lyase. Background technique [0002] With the continuous emergence of drug resistance, phages have become one of the hot spots for researchers to develop new biological agents. However, phage itself cannot survive without the host bacteria, may bring resistance genes, and may cause virulence transmission, making it still controversial whether people should develop phage preparations to prevent and treat bacterial infections. Therefore, there is an urgent need to find a safer and more effective method for the prevention and treatment of bacterial infections. As a new type of biological antibacterial agent, phage lyase has many advantages and has also been favored by researchers. Phage lyses (bacteriophage lysins) are enzymes produced by double-...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N9/36C12N15/56C12N15/63C12N1/21A61K38/47A61P31/04C12R1/19
CPCA61K38/51C12N9/88
Inventor 任慧英张灿王元超卢国民孙虎芝王婷邹玲刘文华
Owner QINGDAO AGRI UNIV
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More