Bacteriophage lysin with improved antibacterial effect
A lysozyme and mutant technology, applied in the field of biomedicine, can solve problems such as speeding up removal
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0020] Example 1: Prokaryotic expression of phage lyase Bp7e mutant
[0021] 1.1 Materials
[0022] Phage lyase Bp7e protein expression plasmid pET28a-Bp7e, Escherichia coli BL21 strain were preserved by Microbiology Laboratory, College of Animal Science and Technology, Qingdao Agricultural University;
[0023] 1.2 Method
[0024] 1.2.1 First-round mutation reaction of amino acids of phage lyase Bp7e
[0025] 1.2.1.1 Design primers for the mutation site of the target gene
[0026] Site-directed mutations were performed on the amino acids of Bp7e (SEQ ID No: 1), so that the 99th position of leucine was mutated into alanine, and the 102nd position of methionine was mutated into glutamic acid. According to the primer design principle of the site-directed mutagenesis kit, two pairs of primers were designed, and the primers were synthesized by Shanghai Bioengineering Technology Service Co., Ltd.
[0027] Primer one upstream: 5'AAGTTCGTCGTTGTGCTGCAATTAACATGGTCTTC3'
[0028] Pri...
Embodiment 2
[0046] Example 2: Detection of antibacterial activity of phage lyase Bp7e and mutant proteins thereof
[0047] 1 Materials and methods
[0048] 1.1 Materials
[0049] Micrococcus lyticus, Escherichia coli, Salmonella, Staphylococcus aureus, Escherichia coli of 01, 015, 024, 078, 088 serotypes are preserved by our laboratory.
[0050] 1.2 Method
[0051] 1.2.1 Purification of phage lyase Bp7e and its mutant proteins
[0052] (1) Assemble the chromatographic column: Mix 1mL filler and add it to the chromatographic column, and let it stand at room temperature for 10 minutes. After the layers are separated, open the liquid outlet at the bottom to let the ethanol flow out slowly by gravity.
[0053] (2) Pick a single colony from the strains expressing the lyase Bp7e and its mutants, and inoculate them in 5 mL of LB liquid culture containing Kana, and cultivate overnight at 37°C with shaking.
[0054] (3) The next day, take out 2.5mL and add 250mL LB liquid culture containing Ka...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 
