Extracellular matrix MMP13 (metalloproteinase-13) detection BRET (bioluminescence resonance energy transfer) probe, gene, expression vector and construction method
A technology of MMP13 and extracellular matrix, which is applied in the field of bioengineering, can solve the problems of damaged cells, undetectable active MMP13 content, unsuitable real-time dynamic monitoring of protease, etc., and achieves high-sensitivity effects
Inactive Publication Date: 2015-07-22
THE SECOND PEOPLES HOSPITAL OF SHENZHEN
View PDF1 Cites 4 Cited by
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
[0004] However, the existing MMP13 detection method is the most commonly used double-antibody sandwich method, which is limited by the specific binding of the antibody and the detection sensitivity, and the operation steps are cumbersome, and the content of active MMP13 cannot be detected; and the detection Cells need to be damaged in the process, and it is not suitable for real-time dynamic monitoring of proteases in vivo
Method used
the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View moreImage
Smart Image Click on the blue labels to locate them in the text.
Smart ImageViewing Examples
Examples
Experimental program
Comparison scheme
Effect test
Embodiment 1
[0051] S10, performing double enzyme digestion (BgIII+PstI) on the pDisplay vector, and recovering the linearized vector after agarose gel electrophoresis;
[0052] With the Rluc8 protein coding gene having the base sequence of the sequence table SEQ.ID.No.3 as a template, the gene sequence of Rluc8 is amplified by PCR, and the gene amplification primers of Rluc8 are as follows:
[0053]
[0054] "TCCCCGCGGCCCAAGCTTAAAACTGCAGT" in the above reverse primer represents MCS (Multiple Cloning Site), including three enzyme cutting sites (PstI+HindIII+SalI).
[0055] The corresponding enzyme cutting sites can be introduced into the PCR, and then the PCR product is double-digested (BgIII+PstI), and finally connected to the cut linearized vector, and the correctness of the sequence is verified by sequencing after transformation. The Rluc8 expression plasmid pDisplay-Rluc8-MCS having the nucleotide sequence of the sequence table SEQ.ID.No.17 was used for the next step.
[0056] S20,...
the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More PUM
Login to View More Abstract
The present invention provides an extracellular matrix MMP13 (metalloproteinase-13) detection BRET (bioluminescence resonance energy transfer) probe, including a BRET bioluminescent donor, a BRET acceptor fluorescent protein, and a MMP13 specifically recognized degraded polypeptide substrate which is used for connecting the BRET bioluminescent donor and the BRET acceptor fluorescent protein; the BRET bioluminescent donor is sea pansy luciferase (Rluc8) with the amino acid sequence of SEQ. ID. No.1, and the BRET acceptor fluorescent protein is a yellow fluorescent protein. The self donor and acceptor protein of the extracellular matrix MMP13 detection BRET probe constructed by the method can be connected by the MMP13 specifically recognized degraded polypeptide substrate to produce BRET, after the polypeptide substrate is specifically recognized degraded by the MMP13, BRET phenomenon disappears, only emitted light emitted by the bioluminescent donor can be detected, emitted light emitted by the fluorescent protein cannot be detected; C-terminal of the Rluc8 protein is fused with a transmembrance domain containing a platelet-derived growth factor receptor, so that the Rluc8 protein can be anchored in the cell membrane surface, live cell extracellular matrix metalloproteinase detection can be performed without damage to the cells, and the probe has higher sensitivity.
Description
technical field [0001] The invention belongs to the technical field of bioengineering, and in particular relates to a BRET probe, gene, expression vector and construction method for detecting extracellular matrix MMP13. Background technique [0002] Matrix metalloproteinases (Matrix metalloproteinases, MMPs) are a group of Zn2+-dependent extracellular enzymes that widely exist in connective tissues and play an important role in the degradation of extracellular matrix. Among them, MMP13, also known as collagenase-3, is an important degrading enzyme in the matrix metalloproteinase (MMPs) family, which can specifically degrade the enzyme of the three-dimensional helical structure in the collagen molecule, and its degradation efficiency for H-type collagen is the highest among all Highest among matrix proteases. [0003] MMP13 is mainly produced by synoviocytes, chondrocytes, neutrophils, etc., and mainly achieves the purpose of cracking cartilage by destroying the peptide chai...
Claims
the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More Application Information
Patent Timeline
Login to View More IPC IPC(8): C07K19/00C09K11/06C12Q1/37C12N15/62C12N15/63C12N15/66
Inventor 王大平梁宇杰段莉李子刚
Owner THE SECOND PEOPLES HOSPITAL OF SHENZHEN