Supercharge Your Innovation With Domain-Expert AI Agents!

The Application of Lebocin Antimicrobial Peptide Lebocin in Pest Control

A technology of lepidopteran insects and antibacterial peptides, which is applied in the application, insecticide, animal repellent and other directions to achieve the effect of reducing harm

Inactive Publication Date: 2017-10-10
SOUTH CHINA NORMAL UNIVERSITY
View PDF3 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

For example, it is clear that the transcription factor Ets regulates the expression of Lebocin in silkworm, but it is only confirmed that it is the result of E. coli induction (Tanaka et al., BmEtsupregulates promoter activity of Lebocin in Bombyx mori , Insect Biochem Mol Biol. , 2012, 42 (7): 474-481)

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • The Application of Lebocin Antimicrobial Peptide Lebocin in Pest Control
  • The Application of Lebocin Antimicrobial Peptide Lebocin in Pest Control
  • The Application of Lebocin Antimicrobial Peptide Lebocin in Pest Control

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0029] Example 1 The midgut cortex of Spodoptera litura whose Lebocin expression is inhibited becomes thin and the worms die

[0030] 1) Construction of Spodoptera litura antibacterial peptide LebocindsRNA vector

[0031] Cloning and ligating Spodoptera litura Lebocin to pMD 18T-Vector (TaKaRa), using double enzyme digestion to obtain a Lebocin cDNA fragment with sticky ends (SEQ ID NO: 1); ligate this fragment with the L4440 vector with the same sticky ends The Lebocin dsRNA vector was obtained, and the obtained Lebocin dsRNA sequence was as shown in SEQ ID NO: 2, and the GFP dsRNA vector was constructed as a control at the same time, and the construction method was the same as that of Lebocin dsRNA.

[0032] The above Lebocin cDNA fragment (SEQ ID NO: 1) of Spodoptera litura is:

[0033] 5'-ATGGGTAAAGTAATTCTTGTACTTTCTGTGCTCGCGGTCTTTTTGGTCGCTGAGTCATCATGCCAGAAATTCATTAGACCTACGTACAGACCTCCACGGCCACGTTACACAGTGGGACCAGTTCGTCCTCATTTAAGAATTCGCCGTGATGCGGGTGACGAGCCGCTCTGGTTGTATCAAGGAGACGTACCGAAG...

Embodiment 2

[0040] Example 2 The midgut cortex of the silkworm larvae whose Lebocin expression is inhibited becomes thin and the worms die

[0041] 1) Synthesis of silkworm antibacterial peptide LebocindsRNA

[0042] According to the instructions of the kit T7 RiboMAX™ Express RNAi System (purchased from Promega), the dsRNA of the silkworm antibacterial peptide Lebocin, Lysozyme, and GFP were synthesized. The dsRNA sequences of the three are as follows:

[0043] The sequence of Bombyx mori Lebocin dsRNA (SEQ ID NO: 3) is:

[0044] 5'-AUGUACAAGUUUUUAGUAUUCAGUUCAGUUCUGGUGCUGUUCUUUGCUCAGGCUUCGUGCCAGAGGUUCAUCCAGCCGACCUUCAGGCCACCGCCAACACAGCGCCCGAUAACACGUACAGUGCGACAAGCUGGCCAGGAACCGCUAUGGCUGUAUCAAGGUGACAAUGUUCCUCGUGCGCCAAGUACCGCAGACCAUCCGAUUCUUCCUUCGAAAAUCGACGACGUGCAGCUCGAUCCAAACCGAAGGUAUGUUCGCAGUGUCACCAAUCCAGAAAAUAACGAGGCGUCCAUUGAACAUUCACAUCAUACAGUUGAUAUUGGACUUGACCAGCCGAUCGAGAGCCACCGUAACACAAGGGACCUGCGGUUUUUGUACCCUCGAGGGAAACUGCCUGUUCCAACGCUUCCUCCGUUUAACCCCAAGCCAAUAUAUAUUGAUAUGGGAAACCGUUACCGACGACAUGCGUCGG...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses the application of a lepidopteran insect antimicrobial peptide Lebocin in pest control. The invention finds that inhibiting the expression of the antimicrobial peptide Lebocin will lead to the thinning of the midgut cortex and the death of the insect body of the lepidoptera insect; wherein the midgut The reason for the thinning of the cortex is not due to the antibacterial effect of the antimicrobial peptide Lebocin. The expression of Lebocin in the insect midgut did not change significantly after feeding with different bacteria, but the expression of Lebocin in the fat body of the immune organ was significantly up-regulated, indicating that Lebocin in the midgut is in the High expression during metamorphosis has nothing to do with its antibacterial effect, but responds to the signal of ecdysone that initiates metamorphosis development, thereby participating in the formation of the midgut cortex; related to development, and related to regeneration of the gut. Based on this, the present invention proposes for the first time that the inhibitor for inhibiting the expression of the antimicrobial peptide Lebocin can be used in the preparation of insecticides.

Description

Technical field [0001] The present invention relates to the application of Lebocin, an antibacterial peptide of lepidopteran insects, in pest control, and specifically relates to the function of Lebocin, a specific antibacterial peptide of lepidopteran insects, that affects the abnormal development of insects, so as to develop transgenic or inhibitor research and development around lebocin to achieve pest control purpose. Background technique [0002] The presence of antimicrobial peptides makes insects have a very powerful immune system, which can effectively resist the invasion of external microorganisms. Antibacterial peptides were originally found in plants, and currently there are more than 800 antibacterial peptides found in animals and plants. According to preliminary statistics, more than 200 insect antibacterial peptides have been discovered, concentrated in Lepidoptera, Coleoptera, Diptera, Hymenoptera, and Hemiptera. Order (Hemiptem), Isoptera (Isoptera), Blattodea (...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): A01N55/00A01P7/04
Inventor 郑思春麦韬毅林献瑜
Owner SOUTH CHINA NORMAL UNIVERSITY
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com