High temperature resistant xylanase mutant and application thereof
A technology of xylanase mutation and xylanase, which is applied in the field of high-temperature-resistant xylanase mutants, can solve the problems of poor thermal stability, application limitations, and the inability to ensure the uniformity of feed distribution and stability of enzyme preparations, etc. problems, to achieve the effect of improved heat resistance
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0030] The amplification of embodiment 1 xylanase gene
[0031] In order to amplify the xylanase gene from Penicillium fungus, the PCR primers XynPF-F1 and XynPF-R1 were designed as follows:
[0032] XynPF-F1: GCTGTTACATCCAACGAGACCGG
[0033] XynPF-R1: TTAAGAGACGGTAATAGTAGAAG
[0034] Using the Penicillium fungus genome as a template, PCR amplification was carried out with the above primers, the PCR product was recovered from the gel, connected to the pEASY-T vector, transformed into Escherichia coli DH5a, and the correct transformant was picked for sequencing. The xylanase encoded by the transformant with correct sequencing was named XynPF, its amino acid sequence was SEQ ID NO: 1, and its nucleotide sequence was SEQ ID NO: 2.
Embodiment 2
[0035] Embodiment 2 Amplification and synthesis of xylanase mutant gene
[0036] In order to improve the heat resistance of xylanase XynPF, a large number of mutations of the enzyme were screened by directed evolution technology, and PCR primers XynPF-F2 and XynPF-R2 were designed as follows:
[0037] XynPF-F2: GGC GAATTC GCTGTTACATCCAACGAGACCGG (the underline is the restriction endonuclease EcoRI recognition site);
[0038] XynPF-R2: ATA GCGGCCGC TTAAGAGACGGTAATAGTAGAAG (the underline is the restriction endonuclease NotI recognition site);
[0039] Using the XynPF gene as a template, use the above primers to perform PCR amplification with the GeneMorph II Random Mutation PCR Kit (Stratagene), recover the PCR product from the gel, digest it with EcoRI and NotI, and connect it to the pET21a vector after the same digestion, and transform coli BL21(DE3), spread on LB+Amp plate, and incubate upside down at 37°C. After the transformants appear, pick them one by one into a 96-we...
Embodiment 3
[0047] The construction of embodiment 3 pichia pastoris engineering strain
[0048] The xylanase mutant gene XynT1, XynT3.1 and XynT3.2 fragments cloned above were connected to the expression vector pPIC9K through the EcoR I and Not I sites respectively, and the expression vectors pPIC9K-XynT1, pPIC9K- XynT3.1, pPIC9K-XynT3.2.
[0049] Linearize pPIC9K-XynT1, pPIC9K-XynT3.1, and pPIC9K-XynT3.2 with Sal I, respectively, and transform the linearized fragments of the expression vectors into Pichia pastoris GS115 by electroporation, and screen them on MD plates to obtain Pichia Yeast engineering strains GS115 / pPIC9K-XynT1, GS115 / pPIC9K-XynT3.1, GS115 / pPIC9K-XynT3.2 were screened for multiple copies of positive transformants on YPD plates containing different concentrations of geneticin.
[0050] The positive transformants of the recombinant expression xylanase XynT1, XynT3.1 and XynT3.2 obtained by screening were named as Pichia pastoris XynT1 (Pichia pastoris XynT1), Pichia past...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More