A kind of high temperature resistant xylanase mutant and its application
A technology of xylanase mutation and xylanase, which is applied in the field of high-temperature-resistant xylanase mutants, can solve problems such as poor thermal stability, increased equipment investment, and application limitations, and achieve the effect of improving heat resistance
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0030] The amplification of embodiment 1 xylanase gene
[0031] In order to amplify the xylanase gene from Penicillium fungus, the PCR primers XynPF-F1 and XynPF-R1 were designed as follows:
[0032] XynPF-F1: GCTGTTACATCCAACGAGACCGG
[0033] XynPF-R1: TTAAGAGACGGTAATAGTAGAAG
[0034] Using the Penicillium fungus genome as a template, PCR amplification was performed with the above primers, the PCR product was recovered by gel, connected to the pEASY-T vector, transformed into Escherichia coli DH5a, and the correct transformant was picked for sequencing. The xylanase encoded by the transformant with correct sequencing was named XynPF, its amino acid sequence was SEQ ID NO: 1, and its nucleotide sequence was SEQ ID NO: 2.
Embodiment 2
[0035] Embodiment 2 Amplification and synthesis of xylanase mutant gene
[0036] In order to improve the heat resistance of xylanase XynPF, a large number of mutations of the enzyme were screened by directed evolution technology, and PCR primers XynPF-F2 and XynPF-R2 were designed as follows:
[0037] XynPF-F2: GGC GAATTC GCTGTTACATCCAACGAGACCGG (the underline is the restriction endonuclease EcoRI recognition site);
[0038] XynPF-R2: ATA GCGGCCGC TTAAGAGACGGTAATAGTAGAAG (the underline is the restriction endonuclease NotI recognition site);
[0039] Using the XynPF gene as a template, use the above primers to perform PCR amplification with the GeneMorph II Random Mutation PCR Kit (Stratagene), recover the PCR product from the gel, perform enzyme digestion with EcoRI and NotI, and connect it to the pET21a vector after the same enzyme digestion, and transform coli BL21(DE3), spread on LB+Amp plate, and incubate upside down at 37°C. After transformants appear, pick them one b...
Embodiment 3
[0047] The construction of embodiment 3 pichia pastoris engineering strain
[0048] The XynT1, XynT3.1 and XynT3.2 fragments of the xylanase mutant genes cloned above were connected to the expression vector pPIC9K through the EcoRI and Not I sites respectively, and the expression vectors pPIC9K-XynT1 and pPIC9K-XynT3 were constructed .1, pPIC9K-XynT3.2.
[0049] Linearize pPIC9K-XynT1, pPIC9K-XynT3.1, and pPIC9K-XynT3.2 with Sal I, respectively, and transform the linearized fragments of the expression vectors into Pichia pastoris GS115 by electroporation, and screen them on MD plates to obtain Pichia Yeast engineering strains GS115 / pPIC9K-XynT1, GS115 / pPIC9K-XynT3.1, GS115 / pPIC9K-XynT3.2 were screened for multiple copies of positive transformants on YPD plates containing different concentrations of geneticin.
[0050] The positive transformants of the recombinant expression xylanase XynT1, XynT3.1 and XynT3.2 obtained by screening were named Pichia pastoris XynT1 (Pichia past...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


