Unlock instant, AI-driven research and patent intelligence for your innovation.

A kind of high temperature resistant xylanase mutant and its application

A technology of xylanase mutation and xylanase, which is applied in the field of high-temperature-resistant xylanase mutants, can solve problems such as poor thermal stability, increased equipment investment, and application limitations, and achieve the effect of improving heat resistance

Active Publication Date: 2018-03-23
QINGDAO VLAND BIOTECH GRP
View PDF5 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Penicillium-derived xylanase has poor thermal stability, and its aqueous solution is incubated at 65°C for 5 minutes, and the remaining enzyme activity is less than 30%, which limits the application of this enzyme in pellet feed
The method of spraying xylanase liquid onto the feed after feed granulation not only increases equipment investment, but also cannot guarantee the stability of the enzyme preparation and the uniformity of distribution in the feed.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A kind of high temperature resistant xylanase mutant and its application
  • A kind of high temperature resistant xylanase mutant and its application
  • A kind of high temperature resistant xylanase mutant and its application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0030] The amplification of embodiment 1 xylanase gene

[0031] In order to amplify the xylanase gene from Penicillium fungus, the PCR primers XynPF-F1 and XynPF-R1 were designed as follows:

[0032] XynPF-F1: GCTGTTACATCCAACGAGACCGG

[0033] XynPF-R1: TTAAGAGACGGTAATAGTAGAAG

[0034] Using the Penicillium fungus genome as a template, PCR amplification was performed with the above primers, the PCR product was recovered by gel, connected to the pEASY-T vector, transformed into Escherichia coli DH5a, and the correct transformant was picked for sequencing. The xylanase encoded by the transformant with correct sequencing was named XynPF, its amino acid sequence was SEQ ID NO: 1, and its nucleotide sequence was SEQ ID NO: 2.

Embodiment 2

[0035] Embodiment 2 Amplification and synthesis of xylanase mutant gene

[0036] In order to improve the heat resistance of xylanase XynPF, a large number of mutations of the enzyme were screened by directed evolution technology, and PCR primers XynPF-F2 and XynPF-R2 were designed as follows:

[0037] XynPF-F2: GGC GAATTC GCTGTTACATCCAACGAGACCGG (the underline is the restriction endonuclease EcoRI recognition site);

[0038] XynPF-R2: ATA GCGGCCGC TTAAGAGACGGTAATAGTAGAAG (the underline is the restriction endonuclease NotI recognition site);

[0039] Using the XynPF gene as a template, use the above primers to perform PCR amplification with the GeneMorph II Random Mutation PCR Kit (Stratagene), recover the PCR product from the gel, perform enzyme digestion with EcoRI and NotI, and connect it to the pET21a vector after the same enzyme digestion, and transform coli BL21(DE3), spread on LB+Amp plate, and incubate upside down at 37°C. After transformants appear, pick them one b...

Embodiment 3

[0047] The construction of embodiment 3 pichia pastoris engineering strain

[0048] The XynT1, XynT3.1 and XynT3.2 fragments of the xylanase mutant genes cloned above were connected to the expression vector pPIC9K through the EcoRI and Not I sites respectively, and the expression vectors pPIC9K-XynT1 and pPIC9K-XynT3 were constructed .1, pPIC9K-XynT3.2.

[0049] Linearize pPIC9K-XynT1, pPIC9K-XynT3.1, and pPIC9K-XynT3.2 with Sal I, respectively, and transform the linearized fragments of the expression vectors into Pichia pastoris GS115 by electroporation, and screen them on MD plates to obtain Pichia Yeast engineering strains GS115 / pPIC9K-XynT1, GS115 / pPIC9K-XynT3.1, GS115 / pPIC9K-XynT3.2 were screened for multiple copies of positive transformants on YPD plates containing different concentrations of geneticin.

[0050] The positive transformants of the recombinant expression xylanase XynT1, XynT3.1 and XynT3.2 obtained by screening were named Pichia pastoris XynT1 (Pichia past...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention aims at providing a high temperature resistant xylanase mutant, and the amino acid sequence thereof is SEQ ID NO: 3, 5 and 7. After the wild type xylanase XynPF provided by the invention is processed for 5min under the condition of 65 DEG C, only about 28% of enzyme activity remains, and the residual rate of the enzyme activity is almost 0 after the wild type xylanase XynPF is processed for 5min under the condition of 75 DEG C and 80 DEG C; the xylanase mutant XynT1 containing S103Y single point mutation can maintain above 50% of enzyme activity after being processed for 5min under the condition of 65 DEG C, and can still maintain 35% and 30 % of enzyme activity respectively after being processed for 5min under the condition of 75 DEG C and 80 DEG C; and the xylanase mutant XynT3.1 containing S103Y / T175C / S184C three-point mutation and the xylanase mutant XynT3.2 containing S103Y / N34C / T187C three-point mutation can both maintain above 90% of enzyme activity after being processed for 5min under the condition of 65 DEG C, and can maintain about 45% and 35% of enzyme activity after being processed for 5min under the condition of 75 DEG C and 80 DEG C.

Description

technical field [0001] The invention belongs to the technical field of enzyme gene transformation, and in particular relates to a high-temperature-resistant xylanase mutant and its application. Background technique [0002] Xylan (xylan) widely exists in nature and is an important component of hemicellulose. It is the second most abundant polysaccharide in nature after cellulose, accounting for almost one-third of the renewable organic carbon content of the earth. one-third. Xylan accounts for 15%-30% of dry matter in angiosperms and 7%-12% of dry matter in gymnosperms. However, xylan has a strong anti-nutritional effect, it cannot be digested and absorbed in the digestive tract of animals, and it will affect the absorption and utilization of other nutrients, thus greatly limiting xylan-rich feed (barley, wheat, rye, etc. )Applications. Xylanase refers to the general term of a group of enzymes that can specifically degrade hemicellulose xylan into xylooligosaccharides and...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N9/24C12N15/56C12N15/81C12N1/19C12R1/84
CPCC12N9/248
Inventor 吴秀秀王坤邵弨王华明
Owner QINGDAO VLAND BIOTECH GRP