Method for producing HIV-1 gp41 recombinant antigen by means of Escherichia coli cell-free system

A hiv-1gp41 and recombinant antigen technology, which is applied in the field of Escherichia coli cell-free system to produce HIV-1gp41 recombinant antigen, can solve the problems of low recovery rate, difficulty in renaturation of inclusion bodies, conformational differences, etc., and achieve improved expression efficiency and good immunity Reactivity, damage avoidance effects

Inactive Publication Date: 2015-11-11
ZHEJIANG UNIV
View PDF3 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0003] The HIV-1gp41 recombinant antigen currently used in the market is mainly imported from abroad and is expensive, mainly because HIV-1gp41 is a membrane protein, and its toxicity makes it difficult to express soluble in Escherichia coli
The gp41 antigen proteins currently used in the market are expressed by intercepting part of the dominant epitope of the full-length protein and adding a fusion tag. Although this method can solve the problem of protein expression in cells, the recombinant antigen usually appears in the form of inclusion bodies. However, the renaturation of inclusion bodies is difficult and the recovery rate is low
In addition, the truncated recombinant antigen only contains a partial fragment of the natural antigen, but adds a fusion protein sequence, which will inevitably cause certain differences in the conformation of the recombinant antigen and the natural antigen, thereby affecting its immunoreactivity

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for producing HIV-1 gp41 recombinant antigen by means of Escherichia coli cell-free system
  • Method for producing HIV-1 gp41 recombinant antigen by means of Escherichia coli cell-free system
  • Method for producing HIV-1 gp41 recombinant antigen by means of Escherichia coli cell-free system

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0026] Embodiment 1, the preparation of recombinant vector pIVEX2.4c-gp41, comprises the following steps:

[0027] 1. Utilize the upstream primer and the downstream primer to amplify the gp41 gene from the synthetic HIV-1 gp41 recombinant antigen gene. The gene sequence of the upstream primer is shown in SEQ ID NO.3, and the gene sequence of the downstream primer is shown in SEQ ID NO.4.

[0028] SEQ ID NO.3:

[0029] CATGCCATGGGCGCTGTTGGTATTGGCGCTCTG

[0030] SEQ ID NO.4:

[0031] CGCGGATCCGCCAGCAGGATGCGCTCCAG

[0032] 2. The PCR reaction conditions are: 94°C pre-denaturation for 5 minutes, 94°C denaturation for 30s, 60°C annealing for 30s, 72°C extension for 60s, in which denaturation, annealing, and extension are repeated 30 times, then 72°C for 10min, and finally Cool down to 4°C and take it out.

[0033] 3. Cell-free expression vectors pIVEX2.4c and gp41 PCR products were digested with NcoI and BamHI at 37°C for 4 hours, respectively, and the digested products recove...

Embodiment 2

[0034] Embodiment 2, the preparation of Escherichia coli cell-free system extract, comprises the following steps:

[0035] 1. Pick a single colony of E.coliBL21(DE3) from the plate and inoculate them in 5mL of LB medium respectively, and cultivate overnight at 37°C with a shaker at 200rpm.

[0036] 2. Transfer all the seed liquid cultivated in step 1 to 500 mL of cell-free fermentation medium.

[0037] 3. Cultivate the shake flask inoculated with E.coliBL21(DE3) at 37°C and 200 rpm until the bacterial concentration OD600 is between 1.5 and 2, then the bacteria can be harvested.

[0038] 4. Pour the bacterial liquid obtained in step 3 into a 500mL centrifuge bottle, centrifuge at 6000g at 4°C for 30min to collect the bacterial cells, discard the supernatant, and obtain the E.coliBL21(DE3) extract according to steps 5-14.

[0039] 5. Resuspend the bacteria with pre-cooled Buffer1 (10mM Tris-acetic acid (pH8.2), 60mM potassium acetate, 14mM magnesium acetate, 1mMDTT, 7mMβ-ME), a...

Embodiment 3

[0049] Embodiment 3, the cell-free system expression of HIV-1gp41 recombinant protein, comprises the following steps:

[0050] 1. The E. coli cell-free expression system was prepared by using the E. coli cell-free system extract prepared in Example 2. The names and amounts of the components in the system are shown in Table 1.

[0051] Table 1: Components of Escherichia coli cell-free expression system

[0052] Components V(μL) E.coli BL21(DE3) extract 24 Energy Mix(EM 3.2×) 16 Amino Acid Mix (25mM) 4

[0053] pIVEX2.4c-gp41 5 water or detergent 1 Total 50

[0054] Wherein, wherein detergent is selected from Tween80 (1%), TritonX-100 (0.2%), β-OG (0.75%), DDM (0.1%), Brij78 (0.5%), Brij58 (0.5%) (mass volume Fraction g / ml). The preparation method of EnergyMix (3.2×) is shown in Table 2.

[0055] Table 2 EnergyMix (3.2×) ingredient list

[0056] Components Stock Final conc. Volume(μL) DTT 10...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a method for producing an HIV-1 gp41 recombinant antigen by means of an Escherichia coli cell-free system. The method comprises the steps that an HIV-1 gp41 gene is cloned on a pIVEX2.4c plasmid to obtain a recombinant vector pIVEX2.4c-gp41; the recombinant vector pIVEX2.4c-gp41 is placed into the Escherichia coli cell-free system containing a decontamination agent for expression, and finally affinity chromatography purification is utilized for obtaining the HIV-1 gp41 protein. According to the HIV-1 gp41 protein produced through the HIV-1 gp41 protein, the decontamination agent is added into the reaction system to improve the solubility of the HIV-1 gp41, and the affinity chromatography purification is utilized for obtaining the target protein. The method can effectively improve the production capacity of the HIV-1 gp41 recombinant antigen and is of great significance in producing a series of HIV recombinant antigens by means of the Escherichia coli cell-free system.

Description

technical field [0001] The invention belongs to the field of biochemical industry, and particularly relates to a method for producing HIV-1 gp41 recombinant antigen in an Escherichia coli cell-free system. Background technique [0002] HIV antibody diagnostic reagents, as the main method for primary diagnosis of HIV at present, have huge market value. With the development of biotechnology, the use of genetic engineering to prepare HIV-1gp41 recombinant antigen raw materials with good immune reactivity has far-reaching significance for the development of HIV antibody diagnostic reagents. [0003] The HIV-1gp41 recombinant antigen currently used in the market is mainly imported from abroad and is expensive, mainly because HIV-1gp41 is a membrane protein, and its toxicity makes it difficult to express in soluble form in Escherichia coli. The gp41 antigen proteins currently used in the market are expressed by intercepting part of the dominant epitope of the full-length protein ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N15/70C07K14/16C07K1/22
Inventor徐志南黄磊来力庄冰佳蔡谨
OwnerZHEJIANG UNIV