Unlock instant, AI-driven research and patent intelligence for your innovation.

Recombinant expression vector and construction method thereof, recombinant virus strain and application thereof, recombinant protein and subunit vaccine

An expression vector and recombinant virus technology, applied in the field of animal virology and genetic engineering, can solve the problems of antibody-dependent enhancement, short protective effect, weak cellular immunity, etc., and achieve wide application prospects, good immunogenicity, The effect of product expression and high yield

Inactive Publication Date: 2015-11-11
JILIN HEYUAN BIOENG LIMITED
View PDF0 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] As an RNA virus, the gene of PRRSV is prone to internal errors during synthesis, and point mutations, deletions, additions, and gene recombination between strains can occur, while inactivated vaccines have weak ability to induce cellular immunity and produce short-term protective effects. PRRS also has "antibody-dependent enhancement"

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Recombinant expression vector and construction method thereof, recombinant virus strain and application thereof, recombinant protein and subunit vaccine
  • Recombinant expression vector and construction method thereof, recombinant virus strain and application thereof, recombinant protein and subunit vaccine
  • Recombinant expression vector and construction method thereof, recombinant virus strain and application thereof, recombinant protein and subunit vaccine

Examples

Experimental program
Comparison scheme
Effect test

Embodiment approach

[0048] 1. PCR amplification of PRRSV-GP5 gene and PCV2-Cap gene and construction of recombinant expression plasmid BacSC-Dual-GP5-Cap

[0049] 3. Primer design of PRRSV-GP5 gene and PCV2-Cap gene

[0050] Design specific primers P1, P2, P3 and P4 according to the porcine reproductive and respiratory syndrome GP5 protein gene and the Cap gene sequence of porcine circovirus type 2, and the primer sequences are as follows:

[0051] GP5-P 1 : 5'GCTGCGCGCATGAATGGCATCTTC3'

[0052] GP5-P 2 : 5'GGGGCATGCAAGTGGGGGGTCTTTAAG3',

[0053] Cap-P 3 : 5'GCTCTCGAGAGCAACAACAGCAG3',

[0054] Cap-P 4 : 5'GATCTGCAGGAGACGACCCCATTGTT3'

[0055] According to the cleavage site of the baculovirus BacSC-Dual vector, the cleavage sites XhoI, XbaI, PstI and EcoR were added, and the above primers were synthesized by Shanghai Sangon Bioengineering Company. Specific primers were designed based on the GP5 protein gene of pig blue ear T1 strain and the whole gene sequence of PCV2 Yu A strain, and the ...

Embodiment 1

[0076] Example 1: Construction of recombinant expression plasmid BacSC-Dual-GP5-Cap and expression of recombinant plasmid

[0077] 1. Materials and methods

[0078] 1.1PCR amplification of PRRSV-GP5 and PCV2-Cap genes

[0079] PRRSV-GP5 and PCV2-GP5 and PCV2- ORF2 gene.

[0080] 1.2 Construction of recombinant eukaryotic expression plasmid BacSC-Dual-GP5-Cap

[0081] The PCR product was recovered and purified, double-digested by XhoI, XbaI, PstI and EcoR respectively, ligated, and the ligated product GP5-Cap was cloned into the expression vector BacSC-Dual (purchased from Invitrogen, USA) with the same restriction site Above, obtain the recombinant eukaryotic plasmid BacSC-Dual-GP5-Cap that naturally expresses the GP5-Cap gene (the map of cloning the PRRSV-GP5 and PCV2-Cap genes into the baculovirus BacSC-Dual vector, see figure 2 ), after XhoI and EcoR double digestion identification and PCR identification, it was confirmed that the construction was correct, and no base ...

Embodiment 2

[0104] Example 2: Biological experiment of piglet weaning multisystemic wasting syndrome subunit vaccine of the present invention on piglet immunity

[0105] 1 Experimental materials

[0106] 1.1 Immunization and determination of ELISA titer of GP5-Cap protein

[0107] ·

[0108] Animal experiments were performed in accordance with international animal welfare standards and in compliance with international protocols for animal protection and use of laboratory animals.

[0109] 1.2 Virus neutralization test

[0110]Neutralizing activities of PRRSV and PCV2 were measured in pig sera at days 14 and 28 after primary inoculation using a fluorescent confocal neutralization assay as previously described (Wang et al., 2006). Serum (50 μl) was diluted two-fold in DMEM medium (pH 7.0), starting with a 1:2 dilution. Add equal volumes of PRRSV and PCV2 (200TCID50) solutions to the serum samples and incubate at 37°C for 1h. This mixture was then seeded into 96-well plates containing 4...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
Titeraaaaaaaaaa
Login to View More

Abstract

The invention relates to the technical fields of animal virology and genetic engineering and especially relates to a recombinant expression vector and a construction method thereof, a recombinant virus strain and an application thereof, a recombinant protein and a subunit vaccine. According to the invention, PCR amplification is successfully carried out for amplifying PRRSV-GP5 gene and PCV2-Cap gene and constructing a high-effective recombinant expression plasmid BacSC-Dual-GP5-Cap. In addition, the recombinant protein expressed by the recombinant virus strain is very high in product expression yield. The BacSC-Dual-GP5-Cap subunit vaccine product in the invention is safe to animal. An immune efficacy test result of the vaccine proves that PRRSV and PCV2 researched through a genetic engineering method have a strong immunogenicity. The subunit vaccine has a wide application prospect in the field of prevention and treatment of porcine reproductive and respiratory syndrome and porcine circovirus disease.

Description

technical field [0001] The invention relates to the technical fields of animal virology and genetic engineering, in particular to a recombinant expression vector and its construction method, a recombinant virus strain and its application, a recombinant protein and a subunit vaccine. Background technique [0002] Porcine reproductive and respiratory syndrome (PRRS) is a highly contagious disease. The main manifestations are reproductive disorders in sows and dyspnea in fattening pigs and piglets. GP5 is an important glycoprotein of PRRSV, which can induce the production of neutralizing antibodies and immune protection. Therefore, it can be used as the main target site for studying genetically engineered vaccines against PRRSV. Although inactivated and modified live vaccines are available, their protection is not complete. Therefore, it is a very urgent task to explore and develop an effective vaccine against PRRSV infection. [0003] Porcine circovirus type 2 virus (PCV2 ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/866C07K14/08C07K14/01A61K39/12
Inventor 李秋菊
Owner JILIN HEYUAN BIOENG LIMITED
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More