Recombinant expression vector and construction method thereof, recombinant virus strain and application thereof, recombinant protein and subunit vaccine
An expression vector and recombinant virus technology, applied in the field of animal virology and genetic engineering, can solve the problems of antibody-dependent enhancement, short protective effect, weak cellular immunity, etc., and achieve wide application prospects, good immunogenicity, The effect of product expression and high yield
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment approach
[0048] 1. PCR amplification of PRRSV-GP5 gene and PCV2-Cap gene and construction of recombinant expression plasmid BacSC-Dual-GP5-Cap
[0049] 3. Primer design of PRRSV-GP5 gene and PCV2-Cap gene
[0050] Design specific primers P1, P2, P3 and P4 according to the porcine reproductive and respiratory syndrome GP5 protein gene and the Cap gene sequence of porcine circovirus type 2, and the primer sequences are as follows:
[0051] GP5-P 1 : 5'GCTGCGCGCATGAATGGCATCTTC3'
[0052] GP5-P 2 : 5'GGGGCATGCAAGTGGGGGGTCTTTAAG3',
[0053] Cap-P 3 : 5'GCTCTCGAGAGCAACAACAGCAG3',
[0054] Cap-P 4 : 5'GATCTGCAGGAGACGACCCCATTGTT3'
[0055] According to the cleavage site of the baculovirus BacSC-Dual vector, the cleavage sites XhoI, XbaI, PstI and EcoR were added, and the above primers were synthesized by Shanghai Sangon Bioengineering Company. Specific primers were designed based on the GP5 protein gene of pig blue ear T1 strain and the whole gene sequence of PCV2 Yu A strain, and the ...
Embodiment 1
[0076] Example 1: Construction of recombinant expression plasmid BacSC-Dual-GP5-Cap and expression of recombinant plasmid
[0077] 1. Materials and methods
[0078] 1.1PCR amplification of PRRSV-GP5 and PCV2-Cap genes
[0079] PRRSV-GP5 and PCV2-GP5 and PCV2- ORF2 gene.
[0080] 1.2 Construction of recombinant eukaryotic expression plasmid BacSC-Dual-GP5-Cap
[0081] The PCR product was recovered and purified, double-digested by XhoI, XbaI, PstI and EcoR respectively, ligated, and the ligated product GP5-Cap was cloned into the expression vector BacSC-Dual (purchased from Invitrogen, USA) with the same restriction site Above, obtain the recombinant eukaryotic plasmid BacSC-Dual-GP5-Cap that naturally expresses the GP5-Cap gene (the map of cloning the PRRSV-GP5 and PCV2-Cap genes into the baculovirus BacSC-Dual vector, see figure 2 ), after XhoI and EcoR double digestion identification and PCR identification, it was confirmed that the construction was correct, and no base ...
Embodiment 2
[0104] Example 2: Biological experiment of piglet weaning multisystemic wasting syndrome subunit vaccine of the present invention on piglet immunity
[0105] 1 Experimental materials
[0106] 1.1 Immunization and determination of ELISA titer of GP5-Cap protein
[0107] ·
[0108] Animal experiments were performed in accordance with international animal welfare standards and in compliance with international protocols for animal protection and use of laboratory animals.
[0109] 1.2 Virus neutralization test
[0110]Neutralizing activities of PRRSV and PCV2 were measured in pig sera at days 14 and 28 after primary inoculation using a fluorescent confocal neutralization assay as previously described (Wang et al., 2006). Serum (50 μl) was diluted two-fold in DMEM medium (pH 7.0), starting with a 1:2 dilution. Add equal volumes of PRRSV and PCV2 (200TCID50) solutions to the serum samples and incubate at 37°C for 1h. This mixture was then seeded into 96-well plates containing 4...
PUM
Property | Measurement | Unit |
---|---|---|
Titer | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap