Bacillus DY26-004 and application thereof to prevention and control of plant pathogenic fungi
A Bacillus, plant pathogenic technology, applied in the application, plant growth regulators, botanical equipment and methods, etc., can solve the problem of few microorganisms, and achieve simple fermentation medium, broad antifungal spectrum, and obvious antibacterial effect. Effect
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0024] Example 1: Isolation and screening of Bacillus sp. DY26-004
[0025] The present invention relates to bacillus ((Bacillussp.) DY26-004, which is isolated by the applicant from the sediment samples collected during the 26th Oceanic Science Expedition in China. The bacterium grows on LB medium and cultures at 28°C for 24 hours. The bacteria are drop-shaped, light white, and the colonies are large, see figure 1 .
Embodiment 2
[0026] Embodiment 2: Bacillus sp. (Bacillus sp.) DY26-004 strain identification
[0027] Bacillus DY26-004 was identified by 16SrRNA gene sequencing. The sequence of the ocean-derived strain DY26-00416SrDNA was amplified using universal primers. The sequence of the forward primer 27F was: AGAGTTTGATCCTGGCTCAT, and the sequence of the reverse primer 1492R was: ACGGCTACCTTGTTACGACTT. The total DNA of Bacillus spp. DY26-004 was used as the PCR amplification template for PCR reaction. The reaction conditions were: denaturation at 94°C for 1 min; annealing at 55°C for 1 min; extension at 72°C for 1.5 min, 30 cycles. The amplified gene was sent to a sequencing company for sequencing. After obtaining the 16S rDNA sequence of the strain, the sequence was compared and analyzed by the National Center for Biotechnology Information (NCBI) and the nucleic acid data in GeneBank ( http: / / ncbi.nlm.nih.gov / blast ). The results showed that the sequence similarity between DY26-00416SrDNA seq...
Embodiment 3
[0028] Embodiment 3: the mensuration of phytopathogenic fungi antimicrobial spectrum
[0029] Activate the bacillus DY26-004 obtained in Example 1 on LB liquid medium, then transfer it into 50mL LB culture medium with 1% inoculum, shake and cultivate it at 28°C at 200r / min for 2 days, filter and sterilize after centrifugation to prepare The sterile fermentation supernatant was used for later use. The inhibitory activity of Bacillus DY26-004 against 10 plant pathogenic fungi was determined by filter paper method.
[0030] Use a sterile puncher with a diameter of 6 mm to make the test pathogenic fungi into bacterial blocks, place them in the center of the potato solid medium (PDA) plate, and culture them at 28°C for 1 to 2 days, and wait for the test pathogenic fungi to grow. After the filaments diffuse and grow, place a number of sterilized double-layer filter paper sheets with a diameter of 6mm around each bacterial block. The filter paper is 0.5-1cm away from the edge of the...
PUM
Property | Measurement | Unit |
---|---|---|
Aperture | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap