New strain of bacillus thuringiensis and application thereof
A technology of Bacillus thuringiensis and bacteria agent, applied in the field of Bacillus thuringiensis and its application in agricultural pest control, can solve the problem of undiscovered resistance and other problems
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0021] Example 1 contains a variety of cry Screening and Identification of Genes of Bacillus thuringiensis
[0022] The soil was collected from the soil in Chengdu City, Sichuan Province. Using the sodium acetate-antibiotic separation method, weigh 10 g of soil samples and put them into a shaker flask filled with 50 ml of sodium acetate medium, add penicillin sodium salt and gentamicin sulfate at 400 μg / ml each, and culture on a shaking table (200 r / min , 30°C) 4h. After the cultivation, take 10ml of soil suspension, put it into a sterile centrifuge tube and centrifuge at 3000r / min for 15min, take 2ml of the upper cloudy solution and place it in a water bath at 65°C for 15min, take 0.1ml of the heat-treated cloudy solution and spread it on a plate, and place the plate in a 30°C incubator cultivated in. After 48 hours, smears of Bt-like strains were picked from the plate. A Bt strain with rhombohedral crystal morphology was found (see attached figure 1 ). Observed by op...
Embodiment 2
[0023] In Example 2 bacterial strain BN23-5 cry Identification of genes
[0024] according to cry Design a pair of specific primers for the conserved sequence of class 1 genes:
[0025] K5un2 (SEQ ID NO1): AGGACCAGGATTTACAGGAGG
[0026] K3un2 (SEQ ID NO2): GCTGTGACACGAAGGATATAGCCAC
[0027] Use the following PCR reaction system for identification:
[0028] 10×buffer2.5μl
[0029] MgCl 2 (25mM) 1.5μl
[0030] Taq enzyme 0.2μl
[0031] dNTPs (2.5mM) 2μl
[0032] Primer 2μl
[0033] Template 5 μl μ
[0034] Final reaction volume 25 μl
[0035] Thermal cycle reaction: pre-denaturation at 94°C for 5 min; denaturation at 94°C for 1 min, annealing temperature depends on the primer, extension at 72°C for 2 min, 30 cycles; extension at 72°C for 5 min; stop reaction at 4°C. The amplification reaction products were electrophoresed on 1% agarose gel, and the PCR amplification results were observed in a gel imaging system. The result is as image 3 As shown, the above prime...
Embodiment 3c
[0036] Example 3 cry1Ha-like gene cloning
[0037] Genomic DNA purification kit (purchased from Saibaisheng Company) was used to extract the total DNA of strain BN23-5; design its full-length gene primers P1 and P2 (primer sequences are as follows); Primers carry out PCR amplification, and reaction system and reaction procedure are with embodiment 2; Amplify with primer P1 and P2 cry1Ha-like The full-length gene obtained a 3507bp fragment (see attached Figure 4 ). The purified PCR product was connected to the pGEM-T vector, transformed, and positive clones containing the target fragment were picked and sequenced to obtain the sequence SEQIDNo.1 respectively.
[0038] P1 (SEQ ID NO3): 5'ATGGAGAATAAAAATCAACAC3'
[0039] P2 (SEQ ID NO4): 5'CTATTCCTCCATAAGGAG3'
[0040] cry1Ha-like gene sequence analysis
[0041] The full length of the sequence SEQIDNo.7 is 3507bp, the analysis shows that the GC content is 39.58%, and it encodes a protein consisting of 1169 amino acids....
PUM

Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com