Application of soybean E3 ubiquitin ligase gene GmPUB2 capable of regulating flowering of plants

A ubiquitin ligase and plant technology, applied in the field of biogenetic engineering, can solve the problems such as the unseen soybean E3 ubiquitin ligase

Active Publication Date: 2016-03-16
NANJING AGRICULTURAL UNIVERSITY
View PDF1 Cites 7 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

In recent years, the function of E3 ubiquitin ligase in the regulation of plant response to biotic and abiotic stress has been more and more studied, and its regulation in plant growth and development has gradually been recognized, but there is no soybean E3 ubiquitin ligase. Report on the Participation of Ligase in Regulating Flowering in Plants

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of soybean E3 ubiquitin ligase gene GmPUB2 capable of regulating flowering of plants
  • Application of soybean E3 ubiquitin ligase gene GmPUB2 capable of regulating flowering of plants
  • Application of soybean E3 ubiquitin ligase gene GmPUB2 capable of regulating flowering of plants

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0028] Embodiment 1: Obtaining of GmPUB2 gene

[0029] 1. RNA extraction:

[0030] (1) Sample processing: collect about 100 mg of soybean leaf tissue, grind it in liquid nitrogen, add 1 mL of lysate RZ, shake and mix.

[0031] (2) Place the homogenized sample at room temperature for 5 minutes to completely separate the nucleic acid-protein complex.

[0032] (3) Centrifuge at 12,000 rpm for 5 minutes at 4°C, take the supernatant, and transfer it to a new RNase-free centrifuge tube.

[0033] (4) Add 200 μl of chloroform, cover the tube cap, shake vigorously for 15 sec, and place at room temperature for 3 min.

[0034] (5) 4°C, 12000rpm centrifuge for 10min, the sample will be divided into three layers: RNA is mainly in the water phase, transfer the water phase to a new tube, and proceed to the next step.

[0035] (6) Slowly add 0.5 times the volume of absolute ethanol, mix well, transfer to the adsorption column CR3, centrifuge at 12000rpm at 4°C for 30sec, and discard the wa...

Embodiment 2

[0062] Embodiment 2: Construction of plant expression vector

[0063] 1. Obtaining of attB-GmPUB2 product

[0064] According to the Gateway system, linkers attB1 and attB2 are added to the 5' end of the specific primers for amplifying the target gene, and then the DNA is amplified with KOD polymerase to amplify the full-length fragment of the target gene with the linker (attB).

[0065] attB1+GmPUB2F2: 5'‐GGGGACAAGTTTGTACAAAAAAGCAGGCT‐3' (SEQ ID NO.5)

[0066] attB2+GmPUB2R2: 5'‐GGGGACCACTTTGTACAAGAAAGCTGGGT‐3' (SEQ ID NO.6)

[0067] Soybean cDNA was used as a template, and attB1+GmPUB2F2 and attB2+GmPUB2R2 were used as upstream and downstream primers for PCR amplification. The PCR conditions were 94°C for 2min, 94°C for 30sec, 68°C for 2min, 35 cycles, and 68°C for 5min. After the PCR product was sent to BGI for sequencing verification, it was separated and analyzed with 1.0% agarose gel, and the target fragment was recovered and purified.

[0068] 2. Construction of entry...

Embodiment 3

[0076] Example 3: Transformation of Arabidopsis and verification of transgene function

[0077] 1. Transformation of Agrobacterium with pMDC83‐GmPUB2 vector

[0078] Extract the pMDC83-GmPUB2 plasmid, mix it with Agrobacterium EHA105, and transform it by freeze-thaw method. Positive clones were screened on LB medium containing 50 mg / L Rif and 50 mg / L Kan. Then use the upstream primer F1 of GmPUB2 and the downstream primer R1 of GmPUB2 as primers to carry out PCR amplification to detect whether the selected single clone contains the target gene fragment. After the verified clones were multiplied, they were stored at -80°C for later use.

[0079] 2. Genetic Transformation of Arabidopsis

[0080] (1) Seed disinfection: Soak Arabidopsis wild-type seeds in a 1.5mL centrifuge tube containing 1mL deionized water, place it at 4°C for 2 days, take it out, wash it twice with sterilized water in an ultra-clean bench, and suck it away water. Add 75% alcohol to the centrifuge tube, an...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses an application of soybean E3 ubiquitin ligase gene GmPUB2 capable of regulating flowering of plants, namely, the application of the oybean E3 ubiquitin ligase gene GmPUB2 in regulating flowering of plants. A late-flowering plant is obtained after the GmPUB2 gene is transplanted into a target plant through a plant expression vector; an early-flowering plant is obtained after the GmPUB2 gene is transplanted into a target plant through a gene silencing carrier; after the target gene GmPUB2 is transplanted into arabidopsis thaliana, compared with the wild arabidopsis thaliana, the results show that the bolting time and the flowering time of the transgenic plant are obviously later than those of the wild plant, namely, the GmPUB2 gene has the function of delaying the flowering of the plants. With the established GmPUB2 gene silencing carrier to silence the transgenic arabidopsis thaliana with over-expressed target gene GmPUB2, the results show that the flowering time of the plant after silencing is obviously earlier than that of a control plant.

Description

technical field [0001] The invention belongs to the technical field of biological genetic engineering and relates to the application of soybean E3 ubiquitin ligase gene GmPUB2 for regulating plant flowering. Background technique [0002] Flowering is an important process for plants to transform from vegetative growth to reproductive growth. Flowering time is an important agronomic trait, which determines whether crops adapt to the light temperature and growing cultivation season in a specific area. Plant flowering is a key point in the transition of plants from vegetative growth to reproductive growth, and it has strong plasticity. Under the influence of various external environments and internal factors, plants will choose to flower at an appropriate time and turn to reproductive growth. By adjusting the flowering period, the plants can delay or advance the flowering, so as to control the vegetative growth or reproductive growth of the plants, avoid the damage to the crops...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N15/52C12N9/00C12N15/82A01H5/00
Inventor智海剑王大刚王丽群何卓伟杨永庆杨云华林静
OwnerNANJING AGRICULTURAL UNIVERSITY