Drug-delivery carrier protein based on cholera toxin CT structure as well as in-vitro construction method and application of drug-delivery carrier protein

A cholera toxin and carrier protein technology, applied in the biological field, can solve the problems of non-expression of foreign proteins, heavy load of dormitory bacteria, and impact on expression, and achieve high protein purity, less assembly interference, and strong repeatability

Inactive Publication Date: 2016-04-20
INT HEALTHCARE INNOVATION INST JIANGMEN
View PDF2 Cites 9 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the fact is that CTB has five pairs of disulfide bonds, and it is very easy to form inclusion bodies, and the pentameric unit of CTB cannot be detected by WESTERNBLOT and ELISA in the supernatant
And in the process of operation, it was found that the overexpression of CTB inclusion body will also affect the expression of EGFP-CTA2-TAT protein supernatant, and the double plasmid co-transformation will cause the internal load of dormitory bacteria to be overloaded, making it difficult for bacteria to grow and not express Foreign protein or even direct death

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Drug-delivery carrier protein based on cholera toxin CT structure as well as in-vitro construction method and application of drug-delivery carrier protein
  • Drug-delivery carrier protein based on cholera toxin CT structure as well as in-vitro construction method and application of drug-delivery carrier protein
  • Drug-delivery carrier protein based on cholera toxin CT structure as well as in-vitro construction method and application of drug-delivery carrier protein

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0051] Gene cloning and expression:

[0052] refer to figure 1 and figure 2 , design primers as follows: CGCGGATCCAACACCTCAAAATATTACTGATTT and CAGCCAACTCAGCTTCCTT, used to amplify the target gene sequence CTB from pet28a-CTB, design primers as follows, CGGAATTCCATATGGTGAGCAAGG and CCGCTCGAGCTGTGGTGGAC, used to amplify from the synthetic gene sequence with NdeI / XhoI Gene sequence EGFP-CTA2-TAT. The amplified CTB was cloned into the multiple cloning site 1 of the vector petduet-1 by BamHI / HindIII double digestion, and EGFP-CTA2-TAT was cloned into The vector pet22b, after preliminary identification by enzyme digestion, was sent to Shanghai Bioengineering Co., Ltd. for sequencing, and the transformants with correct sequencing were screened. The positive clones were marked as petduet-CTB and pet22b-EGFP-CTA2-TAT.

Embodiment 2

[0054] Expression and purification of EGFP-CTA2-TAT soluble protein

[0055] Plasmid pet22b-EGFP-CTA2-TAT introduced into host bacteria , That is, in Escherichia coli BL21 (DE3), and realize the expression; the plasmid that has been transformed into pet22b-EGFP-CTA2-TAT is expanded and cultured at a ratio of 1:100 in 2L LB medium rich in 100ug / mL ampicillin, at 37 degrees After culturing in a shaker at 200 rpm until the OD value was 2, IPTG with a final concentration of 1 mM was added to induce the culture for 8 hours. The culture was divided into 300ml centrifuge tubes, centrifuged at 10000rpm, 4°C for 30min, the culture medium was discarded, the bacteria were collected and washed 3 times with 200ml PBS containing 2% tritonx-100, and the bacteria were collected. Add 4ml of PBS containing 2% tritonx-100 to every 100ml of the original culture, and add lysozyme (purchased from Shanghai Sangong) at a final concentration of 200ug / ml, and freeze and thaw repeatedly at -20°C for 3 ...

Embodiment 3

[0057] Purification and Refolding of Cholera Toxin B Subunit Inclusion Body Protein

[0058] The plasmid petduet-CTB was introduced into the host strain BL21(DE3) and expressed. After the plasmid petduet-CTB was transformed into Escherichia coli BL21(DE3), the steps before repeated freezing and thawing were consistent with the steps for obtaining the EGFP-CTA2-TAT protein. After repeated freezing and thawing three times, transfer to a centrifuge, centrifuge at 4 degrees, 10000rpm for 30min, and collect the precipitate. The precipitate was washed three times with buffer I (pH=8.0, 100 mM NaCl, 2% tritonx-100, 20 mM tris-HCl, 5 mM EDTA), followed by successive washing with buffer I of 2M, 4M, 6M, and 8M urea, and the supernatant was collected. SDS PAGE was used to detect whether the CTB monomer in the supernatant was pure. The CTB supernatant with high purity was screened for renaturation. CTB supernatant containing urea was dialyzed and refolded with buffer II (buffer I, 1 mm...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a drug-delivery carrier protein based on a cholera toxin CT structure and an in-vitro construction method of the drug-delivery carrier protein. The drug-delivery carrier protein is a chimeric protein CTB5 / EGFP-CTA2-TAT. The construction method comprises the following steps: constructing carriers petduet-CTB and pet22b-EGFP-CTA2-TAT; introducing host bacteria, carrying purification or renaturation, and assembling an AB5-structured chimeric protein in vitro. The drug-delivery carrier protein prepared by virtue of the construction method is high in purity, is relatively stable and is strong in repeatability; furthermore, no burden is produced during cell expression, and the protein raw material can be rapidly obtained; the drug-delivery carrier protein has high combining activity with GM1 as well as relatively efficient transmembrane capacity.

Description

technical field [0001] The invention relates to the field of biotechnology, in particular to a drug delivery carrier protein based on the CT structure of cholera toxin and its in vitro construction method and application. Background technique [0002] Constructing a carrier to assist large protein drugs to cross the blood-brain barrier with high efficiency, low toxicity, and non-invasiveness to treat central nervous system disorders is a current research hotspot. Human immunodeficiency virus HIV transactivator TAT is a short peptide rich in a large number of cations. Current research shows that the fusion protein formed by the fusion of TAT and the target protein gene can enter into Cells, the current research shows that the TAT fusion protein can enter the cells within 1 hour at a dose of 100ug / ml, and the protein distribution rate in the cells is over 70%. Therefore, there is no doubt that the TAT fusion protein can significantly improve the transmembrane ability of the t...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C07K19/00C12N15/70A61K38/16A61K47/48A61P35/00
CPCA61K38/00C07K14/28C07K2319/10C07K2319/55C07K2319/60C12N15/62Y02A50/30
Inventor郑希林卫萍王华倩杜志云张焜
OwnerINT HEALTHCARE INNOVATION INST JIANGMEN