Vector of rice respiratory burst oxidase gene OsRboh(LOC_Os01g25820) and application thereof
An oxidase and rice technology, applied in the field of genetic engineering, can solve problems such as unclear functions of rice
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0023] Example 1: Construction of rice PHB-OsRboh (LOC_Os01g25820)-OE vector
[0024] (1) Amplification of OsRboh(LOC_Os01g25820) gene
[0025] According to the OsRboh (LOC_Os01g25820) full-length cDNA (AK065117) sequence published on NCBI, design primers at both ends:
[0026] OsRboh-OE-F: AGATC TATGGCTGACCTGGAAGCAGGCATGG (BamHI)
[0027] OsRboh-OE-R: CACGTG TTAGAAGTTCTCCTTGTGGAAATCA(XbaI)
[0028] The full length of OsRboh (LOC_Os01g25820) was obtained by PCR amplification with the high-fidelity enzyme KOD-Plus using the plasmid AK065117 purchased from the Rice Genome Research Center (RGRC) of Japan as a template. The PCR reaction conditions were: 94°C for 5 min; 94°C for 30 s; 56°C for 30 s; 68°C for 3.0 min, 35 cycles; 68°C for 5 min. The PCR product was detected by electrophoresis with 1.2% agarose, and the size of the amplified fragment was about 2718bp, which was consistent with the expected size ( figure 1 ).
[0029] (2) Gel recovery of OsRboh (LOC_Os01g2582...
Embodiment 2
[0037] Embodiment 2: PHB-OsRboh (LOC_Os01g25820)-OE transfected Agrobacterium EHA105
[0038] (1) Preparation of Agrobacterium Competent Cells
[0039] Pick a single colony of Agrobacterium EHA105 and inoculate it in 5ml of YEB medium, shake it overnight at 28°C, inoculate it in 50ml of YEB medium at a ratio of 1:100, and continue culturing at 28°C for about 6-7h until OD600=0.4-0.6. Put the bacterial solution on ice for 30min; centrifuge at 5000rpm at 4°C for 5min, discard the supernatant, and suspend the bacteria in 10ml of 0.15M NaCl; 2 , 4°C) to suspend gently, aliquot 200 μl per tube, or add sterile glycerol with a final concentration of 20%, and store at -70°C.
[0040] (2) Transformation and identification of Agrobacterium
[0041] Add 10 μl of plasmid DNA to 200 μl of Agrobacterium competent, mix evenly, ice-bath for 30 minutes, freeze in liquid nitrogen for 3-5 minutes, bathe in water at 37°C for 5 minutes, add 1ml of YEB medium, and shake at 28°C for 3-4 hours. Ce...
Embodiment 3
[0042] Embodiment 3: Agrobacterium EHA105 containing PHB-OsRboh (LOC_Os01g25820) transforms rice
[0043] (1) Pretreatment of materials
[0044] The dry seeds are first dehulled, and the dehulled seeds are soaked in 70% ethanol for 1 minute, and then soaked in 50% bleach
[0045] (containing 2% HClO) for 20 minutes, then washed 4 times with sterile water, and transferred the whole seed to MD2 medium
[0046] Plates were cultured in the dark at 26°C for 4 days. When the yellow callus appears on the hypocotyl (usually takes four days, at this
[0047] period, the root is usually 2-5cm long), excised the root and endosperm, and transferred the hypocotyl to a fresh NBD2
[0048] Medium plates, with the blunt side up, cultured in the dark at 26°C for 7-10 days.
[0049] (2) Pick a single colony of Agrobacterium EHA105 and culture it with shaking in 100ml of YEB medium containing corresponding resistance.
[0050] Raise for about 16 hours (200rpm, 28°C), until the OD600 is abou...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap