Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Engineering bacterium with overexpressed uridine diphosphoglucose pyrophosphorylase gene and establishment thereof

A technology of phosphorylase gene and uridine diphosphate, which is applied in genetic engineering, plant gene improvement, enzymes, etc., can solve the problems of unclear regulation mechanism and low flocculation activity of polysaccharide flocculants, so as to reduce costs, increase production, and improve yield effect

Active Publication Date: 2016-06-01
XIAMEN UNIV
View PDF5 Cites 5 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] The purpose of the present invention is to provide a Bacillus licheniformis genetically engineered strain overexpressing the uridine diphosphate glucose pyrophosphorylase gene (gtaB) for the problems of the low flocculation activity of the polysaccharide flocculant in the prior art and the unclear regulation mechanism. its construction method

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Engineering bacterium with overexpressed uridine diphosphoglucose pyrophosphorylase gene and establishment thereof
  • Engineering bacterium with overexpressed uridine diphosphoglucose pyrophosphorylase gene and establishment thereof
  • Engineering bacterium with overexpressed uridine diphosphoglucose pyrophosphorylase gene and establishment thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0030] Example 1: Construction of recombinant expression vector PHY300-gtaB

[0031] Design PCR primers for amplifying the gtaB gene fragment.

[0032] The upstream and downstream primers are:

[0033] Upstream primer: TTGGTACCATGAAAAAAGTAAGAAAAG (the underline is the KpnI restriction site)

[0034] Downstream primer: GGACTAGTTTATATTTCTTCTTTTTATTTAAAAGA (the underline is the SpeI restriction site)

[0035] Using BacilluslicheniformisCGMCC2876 genomic DNA as a template, carry out the following PCR program: (1) 94°C, 5min; (2) 94°C, 30s; (3) 55°C, 30s; (4) 72°C, 1min, step (2)~( 4) Repeat 35 cycles; (5) 72°C, 10min, 4°C storage.

[0036] The PCR reaction system is shown in Table 1.

[0037] Table 1

[0038]

[0039] The PCR product and the expression vector PHY300PLK-PamyL-TTamyL were double-digested with restriction endonucleases KpnI and SpeI respectively, and after recovery, the PCR product and the expression vector were treated with T4 DNA ligase at a ratio of (3-5): 1...

Embodiment 2

[0040] Embodiment 2: Construction of Bacillus licheniformis genetically engineered bacteria HN301-2

[0041] After the PHY300-gtaB overexpression plasmid was extracted and concentrated, it was transformed into Bacillus licheniformis by electric shock, recovered at 37°C for 5 hours, coated with a tetracycline-resistant plate, and cultured at 37°C for 12 hours to screen transformants. After the transformant was extracted from the plasmid, it was verified by PCR and double enzyme digestion (such as figure 1 ). Thus, the Bacillus licheniformis engineering strain HN301-2 overexpressing the uridine diphosphate glucose pyrophosphorylase gene gtaB was obtained.

[0042] The specific steps of electroconversion are as follows:

[0043] Preparation of Bacillus licheniformis competent:

[0044] (1) Inoculate a ring of B. licheniformis in 50mL of LB medium, culture overnight at 37°C, 200r / min for 12h;

[0045] (2) Take 1 mL of the overnight culture solution and put it into 50 mL of the...

Embodiment 3

[0054] Embodiment 3: Utilize Bacillus licheniformis and its genetically engineered bacteria fermentation to prepare polysaccharide flocculant

[0055] Bacillus licheniformis CGMCC2876 starting strain and the genetically engineered bacterium described in Example 2 were inoculated in the liquid seed culture medium, 37 ℃, 200r / min cultivated 16h, prepared seed culture liquid, inoculated with 4% (V / V) inoculum size In the polysaccharide flocculant fermentation medium, cultivate at 37°C and 200r / min, and carry out the experiment of producing polysaccharide flocculant by fermentation. After 56 hours, the flocculation activity of the fermentation broth and the production of the polysaccharide flocculant (such as figure 2 ). The final flocculation activity of the fermented liquid of the gtaB gene overexpressed recombinant genetically engineered bacteria was 4754U / mL, which was 70% higher than the final flocculated activity of the original strain fermented liquid of 2780U / mL; the cru...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to an engineering bacterium with overexpressed uridine diphosphoglucose pyrophosphorylase gene and establishment thereof, belonging to the technical fields of gene engineering and microbial fermentation. By cloning the key enzyme uridine diphosphoglucose pyrophosphorylase gene in the polysaccharide flocculant synthesis route, an Escherichia coli-Bacillus shuttle plasmid is utilized to establish a recombinant expression vector. The recombinant plasmid is transformed into Bacillus licheniformis by electric transformation to establish recombinant Bacillus licheniformis HN301-2; and compared with the initial strain, the polysaccharide flocculant yield of the recombinant Bacillus licheniformis is enhanced by 15.6%, and the fermentation liquid flocculation activity is enhanced by 70%. The engineering bacterium is hopeful to be used in industrial production of polysaccharide flocculants, and can enhance the yield and lower the cost.

Description

technical field [0001] The invention belongs to the technical field of genetic engineering and microbial fermentation, and in particular relates to a Bacillus licheniformis genetically engineered strain overexpressing a uridine diphosphate glucose pyrophosphorylase gene and a construction method thereof. Background technique [0002] UDP-glucosepyrophosphorylase (UGPase) is widely distributed in plants, animals and bacteria, and is an enzyme closely related to sugar metabolism. The uridine diphosphate glucose (UDPG) catalyzed by it is the main activated form of glucose, which can be used as a donor of glucose groups, as sucrose, starch, cellulose, hemicellulose, pectin, glycolipids, and sugars in cells. Protein, glycogen, β-glucan and other carbohydrate precursors. Studies have shown that uridine diphosphate glucose pyrophosphorylase gene (gtaB) is the key enzyme gene of polysaccharide biosynthesis (Journal of Bacteriology, 176 (9): 2611-2618; Biochemical Journal, 370 (1): ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/54C12N15/75C12P19/04C02F3/34C02F101/20C02F101/30
CPCC02F3/34C02F2101/20C02F2101/308C12N9/1241C12N15/75C12N2800/108C12N2800/60C12Y207/07009
Inventor 何宁陈震王志王远鹏李清彪沈亮
Owner XIAMEN UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com