Engineering bacterium with overexpressed uridine diphosphoglucose pyrophosphorylase gene and establishment thereof
A technology of phosphorylase gene and uridine diphosphate, which is applied in genetic engineering, plant gene improvement, enzymes, etc., can solve the problems of unclear regulation mechanism and low flocculation activity of polysaccharide flocculants, so as to reduce costs, increase production, and improve yield effect
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0030] Example 1: Construction of recombinant expression vector PHY300-gtaB
[0031] Design PCR primers for amplifying the gtaB gene fragment.
[0032] The upstream and downstream primers are:
[0033] Upstream primer: TTGGTACCATGAAAAAAGTAAGAAAAG (the underline is the KpnI restriction site)
[0034] Downstream primer: GGACTAGTTTATATTTCTTCTTTTTATTTAAAAGA (the underline is the SpeI restriction site)
[0035] Using BacilluslicheniformisCGMCC2876 genomic DNA as a template, carry out the following PCR program: (1) 94°C, 5min; (2) 94°C, 30s; (3) 55°C, 30s; (4) 72°C, 1min, step (2)~( 4) Repeat 35 cycles; (5) 72°C, 10min, 4°C storage.
[0036] The PCR reaction system is shown in Table 1.
[0037] Table 1
[0038]
[0039] The PCR product and the expression vector PHY300PLK-PamyL-TTamyL were double-digested with restriction endonucleases KpnI and SpeI respectively, and after recovery, the PCR product and the expression vector were treated with T4 DNA ligase at a ratio of (3-5): 1...
Embodiment 2
[0040] Embodiment 2: Construction of Bacillus licheniformis genetically engineered bacteria HN301-2
[0041] After the PHY300-gtaB overexpression plasmid was extracted and concentrated, it was transformed into Bacillus licheniformis by electric shock, recovered at 37°C for 5 hours, coated with a tetracycline-resistant plate, and cultured at 37°C for 12 hours to screen transformants. After the transformant was extracted from the plasmid, it was verified by PCR and double enzyme digestion (such as figure 1 ). Thus, the Bacillus licheniformis engineering strain HN301-2 overexpressing the uridine diphosphate glucose pyrophosphorylase gene gtaB was obtained.
[0042] The specific steps of electroconversion are as follows:
[0043] Preparation of Bacillus licheniformis competent:
[0044] (1) Inoculate a ring of B. licheniformis in 50mL of LB medium, culture overnight at 37°C, 200r / min for 12h;
[0045] (2) Take 1 mL of the overnight culture solution and put it into 50 mL of the...
Embodiment 3
[0054] Embodiment 3: Utilize Bacillus licheniformis and its genetically engineered bacteria fermentation to prepare polysaccharide flocculant
[0055] Bacillus licheniformis CGMCC2876 starting strain and the genetically engineered bacterium described in Example 2 were inoculated in the liquid seed culture medium, 37 ℃, 200r / min cultivated 16h, prepared seed culture liquid, inoculated with 4% (V / V) inoculum size In the polysaccharide flocculant fermentation medium, cultivate at 37°C and 200r / min, and carry out the experiment of producing polysaccharide flocculant by fermentation. After 56 hours, the flocculation activity of the fermentation broth and the production of the polysaccharide flocculant (such as figure 2 ). The final flocculation activity of the fermented liquid of the gtaB gene overexpressed recombinant genetically engineered bacteria was 4754U / mL, which was 70% higher than the final flocculated activity of the original strain fermented liquid of 2780U / mL; the cru...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap