Method for establishing CYP2C11 gene knockout rat model

A CYP2C11, gene knockout technology, applied in the field of transgenic technology, can solve the problems of poor specificity and high off-target rate, and achieve an effect that is beneficial to early toxicity

Inactive Publication Date: 2016-06-01
JIANGSU UNIV
View PDF4 Cites 9 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the CRISPR-Cas9 system is currently facing the problems of high off-target rate and poor specificity, which is undoubtedly the biggest challenge for the application of the CRISPR / Cas9 system in basic research and clinical treatment

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for establishing CYP2C11 gene knockout rat model
  • Method for establishing CYP2C11 gene knockout rat model
  • Method for establishing CYP2C11 gene knockout rat model

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0033] 1. Use the GeneKnock-OutwithCas9 software (provided by Nanjing Yuqi Biotechnology Co., Ltd.) to determine the selection of two specific sgRNA target sequences in the target site exon6 of the CYP2C11 gene (GeneID: 29277). The two target sequences are sgRNA1: GCTACTGTAACTGACATGTT; sgRNA2: TCAAGGGTAAACTCAGACTG

[0034] 2. Construction of Cas9 plasmid expressing sgRNA

[0035] (1) Synthesize 2 pairs of specific sgRNA target sequence primers in Nanjing GenScript Biotechnology Co., Ltd.:

[0036] RatCYP2C11_c9_1-O1: caccGCTACTGTAACTGACATGTT

[0037] and Rat_CYP2C11_c9_1-O2: aaacAACATGTCAGTTACAGTAGC;

[0038] Rat_CYP2C11_c9_2-O1: caccTCAAGGGTAAACTCAGACTG

[0039] and Rat_CYP2C11_c9_2-O2: aaacCAGTCTGAGTTTACCCTTGA

[0040] (2) Take 5 μL of upstream and downstream primers (100 μM) of sgRNA1 and mix them; at the same time, mix 5 μL of upstream and downstream primers (100 μM) of sgRNA2, put them in boiling water, take them out for 20 minutes (94°C~55°C), anneal into double stra...

Embodiment 2

[0076] 1. Breeding of CYP2C11 knockout rats:

[0077] One F1 generation male CYP2C11 knockout rat heterozygous and two SD female mice (provided by Animal Experiment Center of Jiangsu University) were used for breeding. Three months later, 17 offspring were obtained, and the offspring (F2 generation) were identified. The identification results showed that 11 offspring male rats were heterozygous and 6 female rats were heterozygous. The resulting male heterozygotes (CYP2C11 + / - ) with female heterozygotes (CYP2C11 + / - ) as the parents with 1:2 pairing to expand the number of homozygous populations.

[0078] 2. CYP2C11 Genomic DNA Extraction and Identification

[0079] When the offspring rats were 7-14 days old, they were marked with the toe clipping method, the cut tissues were collected, lysate and proteinase K (sigma) were added, and mixed well. overnight at 55°C in a thermostatic shaking box. Add phenol: chloroform: isoamyl alcohol (volume ratio 25:24:1), and mix well. ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a method for establishing a CYP2C11 gene knockout rat model, and belongs to the technical field of transgenosis. The method comprises the steps of firstly determining a target point of a to-be-knocked gene and designing and synthesizing a primer sequence of the gene; inserting the primer sequence into a Cas9-gRNA-Bsal carrier subjected to enzyme digestion and performing amplification to obtain a target point sgRNA with a T7 promoter sequence; after in vitro transcription and purification, performing activity detection; micro-injecting active sgRNA and Cas9 RNA into a rat single-cell embryo to obtain a Founder rat; and after screening out a CYP2C11 gene knockout rat heterozygote, performing mating to obtain a homozygote individual, namely, a CYP2C11 gene knockout rat. The invention provides a brand-new preparation method replacing a mouse model with a P450 gene knockout rat model, so that a gene knockout technology is really fused in non-clinical safety evaluation of drugs and early toxicity of candidate drugs can be discovered.

Description

technical field [0001] The invention relates to a method for establishing a CYP2C11 gene knockout rat model, which belongs to the technical field of transgenics. Background technique [0002] Cytochrome P450 (cytochrome P450), also known as mixed-function oxidase or monooxygenase, mainly exists in liver microsomes, where endogenous substances and exogenous substances including drugs and environmental compounds play a key role in the biotransformation of source substances. P450 is the phase I enzyme of drug metabolism, and its activity often plays a decisive role in the metabolism of drugs and the generation of toxic products. About 75% of drugs in the human body are metabolized by CYP. CYP1A2, CYP2C9, CYP2C19, CYP2D6, CYP2E1, and CYP3A4 in humans are related to the metabolism of 95% of existing clinical drugs, while the corresponding CYP1A2, CYP2C11, CYP2C13, CYP2D2, CYP2E1, and CYP3A1 isozymes in rats are two or more When two or more drugs are used in combination, the dr...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N15/89A01K67/027
CPCC12N15/89A01K67/0276A01K2217/075A01K2227/105A01K2267/03C12N9/0071C12Y114/14001
Inventor魏渊张晓燕许海淼
OwnerJIANGSU UNIV