Eureka AIR delivers breakthrough ideas for toughest innovation challenges, trusted by R&D personnel around the world.

Molecular mark used for resistance identification of leaf mustard turnip mosaic virus disease and use of molecular mark

A technology of turnip mosaic virus and molecular markers, which is applied in the fields of application, microbial measurement/inspection, plant peptides, etc., can solve the problems of restricting the development of the mustard vegetable crop industry, and achieve good stability

Active Publication Date: 2016-07-13
ZHEJIANG UNIV
View PDF3 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the most effective solution is to identify germplasm resistant to turnip mosaic virus disease, discover genes resistant to turnip mosaic virus disease, establish a molecular marker-assisted selection method for resistance to turnip mosaic virus in mustard vegetables, and breed turnip flower resistance. Leaf virus disease varieties fundamentally solve the bottleneck problem that limits the development of the mustard vegetable crop industry

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Molecular mark used for resistance identification of leaf mustard turnip mosaic virus disease and use of molecular mark
  • Molecular mark used for resistance identification of leaf mustard turnip mosaic virus disease and use of molecular mark
  • Molecular mark used for resistance identification of leaf mustard turnip mosaic virus disease and use of molecular mark

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0079] Embodiment 1, kohlrabi and pickled mustard are to turnip mosaic virus disease resistance identification

[0080] The specific method is: select the mustard material from the vegetable germplasm resource bank of the Chinese Academy of Agricultural Sciences --- kohlrabi, mustard, kohlrabi and mustard mustard hybrid F1 offspring, inoculate with the pathogenic bacteria of turnip mosaic virus, and use the method of detecting the coat protein of the pathogenic bacteria of turnip mosaic virus Gene (CP) expression, virus content in plants and leaf symptoms were used to determine resistance. like figure 1 .

[0081] 1. Inoculation of viral pathogens:

[0082] 1), prepare virus inoculation PBS buffer

[0083] in ddH 2 Add 8gNaCl, 0.2gKCl, Na 2 HPO 4 1.42g and NaH 2 PO 4 0.27g, with ddH 2 O was fixed to 1 liter, adjusted to pH 7.2, and configured as PBS buffer solution (0.02mol / LPBS buffer solution).

[0084] 2), turnip mosaic virus virus strain

[0085] The turnip mosa...

Embodiment 2

[0126] Example 2. Nucleotide sequence comparison of eIF2Bβ gene of antiviral mustard mustard kohlrabi and susceptible mustard mustard

[0127] The specific method is: select mustard materials kohlrabi and mustard mustard from the vegetable germplasm resource bank of the Chinese Academy of Agricultural Sciences, use eIF2Bβ gene primers to amplify their genome sequences from kohlrabi and mustard, perform sequence comparisons, and find genome-level variation.

[0128] 1. DNA extraction

[0129] 1), DNA extraction

[0130] For DNA extraction, the total plant DNA extraction kit (TIANampGenomicDNAKit) produced by Tiangen Biochemical Technology (Beijing) Co., Ltd. can be selected.

[0131] ①. Weigh 0.1 g of the above mustard leaves and grind them into powder with liquid nitrogen, and then extract the total DNA according to the operation steps provided by the DNA extraction kit.

[0132] ②. Use a Nanodrop2000 ultra-micro spectrophotometer to detect the concentration of the DNA sampl...

Embodiment 3

[0152] Example 3, Identification of polymorphisms and genetic analysis of kohlrabi and pickled mustard with PCR marker BjTuR

[0153] The specific method is: select the mustard material kohlrabi and mustard mustard from the vegetable germplasm resource bank of the Chinese Academy of Agricultural Sciences, cross the kohlrabi and mustard to obtain its F1, then self-cross F1 to obtain F2, and at the same time backcross F1 and mustard to obtain BC1, use primer PCR Marker BjTuR was amplified to identify its polymorphism and genetic segregation rules.

[0154] 1. DNA extraction

[0155] With embodiment 2.

[0156] 2. PCR amplification

[0157] 1), reaction system

[0158] The primer sequences were changed as follows:

[0159] BjTuR: forward primer (F): GTTAATGGGAAAGGGATTGGGTATCCTTG;

[0160] Reverse primer (R): ATAGCTTGCTCGGCGATCTGCTCAT.

[0161] The rest are equal to Example 2.

[0162] 2), reaction procedure

[0163] With embodiment 2.

[0164] 3. Electrophoresis detectio...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a leaf mustard turnip mosaic virus disease resistant gene eIF2B beta. A nucleotide sequence of the gene is as shown in SEQ ID NO:1; and an amino acid sequence of a protein coded by the gene is as shown in SEQ ID NO:2. The invention further discloses a molecular mark BjTur, used for resistance identification of leaf mustard turnip mosaic virus disease, developed based on the leaf mustard turnip mosaic virus disease resistant gene eIF2B beta. The leaf mustard turnip mosaic virus disease resistant gene has the function of resisting the leaf mustard turnip mosaic virus disease. The use of the molecular mark BjTuR is used for identifying a leaf mustard turnip mosaic virus disease resistant strain or offspring marker assisted selection thereof.

Description

technical field [0001] The invention belongs to the technical field of vegetable disease-resistant molecular marker development and molecular marker-assisted breeding, and specifically relates to the development and application of molecular markers for mustard mosaic virus disease resistance, which is a high-throughput screening for mustard mosaic virus disease resistance. Identification and backcross breeding provide a novel molecular marker and assisted selection method. Background technique [0002] Turnip mosaic virus disease is one of the main diseases infecting mustard, which seriously affects the growth and yield of mustard plants, and the year when the virus disease occurs seriously leads to extinction. The external phenotypes of the mustard greens infected with the virus are as follows: the infected plants show dwarfism, the inoculated leaves die and fall off, while the non-inoculated leaves show yellow and green mosaic symptoms, and the leaves shrink at the same ti...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/29C07K14/415C12N15/11C12Q1/68
CPCC07K14/415C12Q1/6895C12Q2600/13C12Q2600/156
Inventor 杨景华张明方苏珍娜胡仲远
Owner ZHEJIANG UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com