Molecular mark used for resistance identification of leaf mustard turnip mosaic virus disease and use of molecular mark
A technology of turnip mosaic virus and molecular markers, which is applied in the fields of application, microbial measurement/inspection, plant peptides, etc., can solve the problems of restricting the development of the mustard vegetable crop industry, and achieve good stability
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0079] Embodiment 1, kohlrabi and pickled mustard are to turnip mosaic virus disease resistance identification
[0080] The specific method is: select the mustard material from the vegetable germplasm resource bank of the Chinese Academy of Agricultural Sciences --- kohlrabi, mustard, kohlrabi and mustard mustard hybrid F1 offspring, inoculate with the pathogenic bacteria of turnip mosaic virus, and use the method of detecting the coat protein of the pathogenic bacteria of turnip mosaic virus Gene (CP) expression, virus content in plants and leaf symptoms were used to determine resistance. like figure 1 .
[0081] 1. Inoculation of viral pathogens:
[0082] 1), prepare virus inoculation PBS buffer
[0083] in ddH 2 Add 8gNaCl, 0.2gKCl, Na 2 HPO 4 1.42g and NaH 2 PO 4 0.27g, with ddH 2 O was fixed to 1 liter, adjusted to pH 7.2, and configured as PBS buffer solution (0.02mol / LPBS buffer solution).
[0084] 2), turnip mosaic virus virus strain
[0085] The turnip mosa...
Embodiment 2
[0126] Example 2. Nucleotide sequence comparison of eIF2Bβ gene of antiviral mustard mustard kohlrabi and susceptible mustard mustard
[0127] The specific method is: select mustard materials kohlrabi and mustard mustard from the vegetable germplasm resource bank of the Chinese Academy of Agricultural Sciences, use eIF2Bβ gene primers to amplify their genome sequences from kohlrabi and mustard, perform sequence comparisons, and find genome-level variation.
[0128] 1. DNA extraction
[0129] 1), DNA extraction
[0130] For DNA extraction, the total plant DNA extraction kit (TIANampGenomicDNAKit) produced by Tiangen Biochemical Technology (Beijing) Co., Ltd. can be selected.
[0131] ①. Weigh 0.1 g of the above mustard leaves and grind them into powder with liquid nitrogen, and then extract the total DNA according to the operation steps provided by the DNA extraction kit.
[0132] ②. Use a Nanodrop2000 ultra-micro spectrophotometer to detect the concentration of the DNA sampl...
Embodiment 3
[0152] Example 3, Identification of polymorphisms and genetic analysis of kohlrabi and pickled mustard with PCR marker BjTuR
[0153] The specific method is: select the mustard material kohlrabi and mustard mustard from the vegetable germplasm resource bank of the Chinese Academy of Agricultural Sciences, cross the kohlrabi and mustard to obtain its F1, then self-cross F1 to obtain F2, and at the same time backcross F1 and mustard to obtain BC1, use primer PCR Marker BjTuR was amplified to identify its polymorphism and genetic segregation rules.
[0154] 1. DNA extraction
[0155] With embodiment 2.
[0156] 2. PCR amplification
[0157] 1), reaction system
[0158] The primer sequences were changed as follows:
[0159] BjTuR: forward primer (F): GTTAATGGGAAAGGGATTGGGTATCCTTG;
[0160] Reverse primer (R): ATAGCTTGCTCGGCGATCTGCTCAT.
[0161] The rest are equal to Example 2.
[0162] 2), reaction procedure
[0163] With embodiment 2.
[0164] 3. Electrophoresis detectio...
PUM

Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com