Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Primer, kit and method for detecting genetic mutation related to myeloproliferative neoplasms MPN

A technology for bone marrow proliferation and kit, applied in the field of genetic engineering, can solve the problems of poor primer specificity, high background peaks in sequencing peaks, difficulty, etc., and achieve the effects of saving detection time and cost, clear background, and cost-effectiveness.

Inactive Publication Date: 2017-02-22
SHANGHAI TISSUEBANK MEDICAL LAB CO LTD
View PDF3 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

At present, there are many reports on the detection of MPN-related gene mutations by direct sequencing. However, the specificity of primers is often not very good, resulting in high background peaks in the sequencing peaks, which makes it difficult to judge mutations.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Primer, kit and method for detecting genetic mutation related to myeloproliferative neoplasms MPN
  • Primer, kit and method for detecting genetic mutation related to myeloproliferative neoplasms MPN
  • Primer, kit and method for detecting genetic mutation related to myeloproliferative neoplasms MPN

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0028] Example 1: Design of PCR primers for detection of MPN-related 3 gene mutations

[0029] In this example, according to the latest gene sequence published by GenBank, PCR primers were designed using Primer Premier 5.0 primer design software, and synthesized by Sangon Bioengineering (Shanghai) Co., Ltd. In order to reduce the bottom peak of the sequencing peak diagram and ensure the purity of the sequencing primers to the greatest extent, primers with good specificity were screened out through optimization and comparison of primer reaction conditions. According to the above-mentioned primer design principles, see Table 1 for the specific primers designed by the present invention for the three MPN-related gene mutations.

[0030] Table 1: Amplification and sequencing primer sequences of three genes

[0031] Primer name sequence JAK2-12F-P TGGCAGGAATACATCAAAAATCCA JAK2-12R-P ACATCTAACACAAGGTTGGCA JAK2-14F-P CCAGGCTTACACAGGGGTTT JAK2-14R...

Embodiment 2

[0032] Example 2: Preparation of kits for detecting 3 gene mutations related to MPN

[0033] The synthesized primers, PCR amplification reaction solution and sequencing system are subpackaged and packaged to form the kit of the present invention.

[0034] Among them, the PCR amplification reaction solution includes, 10×PCR Buffer, 2.5mMdNTPs, LA Taq DNAPolymerase, ddH 2 O et al.

[0035] The sequencing system includes: (1) PCR product digestion reaction solution: Alkaline Phosphatas (Shrimp) and Exonuclease I are mixed at a ratio of 1:1; (2) sequencing reaction solution: Terminator V3.1 cycle Sequencing Kit, 5×Bigdye buffer, ddH 2 O; (3) sequencing purification solution: EDTA (125mM); (4) 85% absolute ethanol; (5) 75% absolute ethanol; (6) HI-DI (highly deionized formamide).

Embodiment 3

[0036] Example 3: Detection of MPN-related gene mutations in samples

[0037] Follow the specific steps below to detect MPN-related gene mutations in samples:

[0038] 1. Extract sample DNA according to the method of QIAamp DNA Blood Mini kit.

[0039] 2. Using the above DNA as a template, carry out a PCR amplification reaction with the PCR amplification primers to obtain a PCR amplification product.

[0040] The obtained PCR amplification product was subjected to agarose gel electrophoresis (the concentration of agarose was 1.5%), the voltage was 140V, and the time was 35min. After the electrophoresis, the gel imaging system was used to observe. Wherein, the PCR amplification system is shown in Table 2.

[0041] Table 2: PCR amplification system

[0042]

[0043] See Table 3 for PCR reaction conditions.

[0044] Table 3: PCR reaction conditions

[0045]

[0046]

[0047] 3. Sanger sequencing

[0048] Add 1 μL of digestive enzyme to each PCR reaction system (25 μL...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the technical field of genetic engineering and discloses a primer combination for genetic mutation related to myeloproliferative neoplasms (MPN), a kit containing the primer combination and a method for detecting the genetic mutation related to the MPN. Aiming at three types of MPN related genes, a primer sequence capable of efficiently and specifically amplifying the three types of genes is designed and has high specificity. The annealing temperature of all the designed primers is 58 DEG C and an amplification reaction can be finished for one time through utilizing the same PCR procedure. According to the primer combination, the kit and the method, disclosed by the invention, a presented sequencing peak diagram has a clear background and a signal value is high; the analysis difficulty of mutation is greatly reduced; and the primer, the kit and the detection method, designed according to the invention, are low in cost and high in specificity.

Description

technical field [0001] The invention relates to the technical field of genetic engineering, in particular to primers, kits and methods for detecting gene mutations related to myeloproliferative neoplasms MPN. Background technique [0002] Myeloproliferative neoplasms (Myeloproliferative Neoplasms, MPN) is a clonal hematopoietic stem cell disease characterized by the proliferation of one or more lines of myeloid cells. It is mainly divided into chronic myeloid leukemia (CML), polycythemia vera (PV), essential thrombocythemia (ET) and primary myelofibrosis (IMF). Except for CML, the Ph chromosome BCR / ABL fusion gene of the other three classical MPNs was negative. [0003] Molecular markers that have been found to be associated with MPN mainly include JAK2, CARL and MPL. In 2005, it was discovered that the JAK2 gene acquired mutation in this type of disease - JAK2V617F point mutation, this mutation has been proved to have important diagnostic and prognostic significance in MP...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/68C12N15/11
CPCC12Q1/6886C12Q1/6869C12Q2600/118C12Q2600/156C12Q2531/113C12Q2527/101
Inventor 郑仲征杜金伟徐玉尚郁晓晨杨兰安雪茹余凯潘捷杜可明王宁娟胡莹
Owner SHANGHAI TISSUEBANK MEDICAL LAB CO LTD
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com