Application of Epstein-Barr virus mir-bart10-5p inhibitor

An Epstein-Barr virus and inhibitor technology, applied in the field of EB virus miR-BART10-5p inhibitor, can solve the problems of damage to normal tissues and organs, increased cytotoxicity, and large irradiation volume, achieving reduced dosage, easy operation, and good treatment Effect

Active Publication Date: 2020-09-11
SHENZHEN HOSPITAL OF SOUTHERN MEDICAL UNIV
View PDF6 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0006] In addition, in the prior art, the preparation of miRNA inhibitors mostly adopts the method of loading antisense oligonucleotides on poly-lysine-modified silicon nanoparticles to make nanospheres. The method involves nano-gold-polyethylene The amine (PEI) gene carrier has toxic and side effects. The transfection efficiency of PEI increases with the increase of the molecular weight, but the cytotoxicity will also increase. Therefore, most of the current research is on the premise of not affecting the transfection efficiency of PEI. Appropriate modification of its structure reduces its cytotoxicity
[0007] At present, the effective radical treatment for nasopharyngeal carcinoma is radiotherapy or radiotherapy-based comprehensive treatment. However, while radiotherapy cures the tumor, it inevitably damages normal tissues and organs. long, more complications

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of Epstein-Barr virus mir-bart10-5p inhibitor
  • Application of Epstein-Barr virus mir-bart10-5p inhibitor
  • Application of Epstein-Barr virus mir-bart10-5p inhibitor

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0036] Embodiment 1, Epstein-Barr virus miR-BART10-5p, Epstein-Barr virus miR-BART10-5p antisense oligonucleotide, Epstein-Barr virus miR-BART10-5p inhibitor

[0037] (1) Epstein-Barr virus miR-BART10-5p

[0038] According to the international public sanger mirbase database, the sequence of Epstein-Barr virus miR-BART10-5p is as follows:

[0039] GCCACCUCUUUGGUUCUGUACA (SEQ ID NO: 1)

[0040] (2) Epstein-Barr virus miR-BART10-5p antisense oligonucleotide

[0041] The antisense design was carried out according to the sequence of Epstein-Barr virus miR-BART10-5p in the international public sanger mirbase database; wherein, the basic principles of probe design were: 1) there were no more than two hairpin structures inside the probe; The similarity between BLAST comparison and other sequences is less than 20%; 3) the repetition of BLAST comparison with other gene sequences is no more than 3 bases; the antisense oligonucleotide sequence is obtained as follows:

[0042] UGUACAGAA...

experiment example 1

[0047] Experimental Example 1, Microtubule Formation Experiment

[0048] Microtubule formation assay was used to detect the effect of Epstein-Barr virus miR-BART10-5p and its inhibitors on the microtubule formation of human umbilical vein endothelial cells HUVEC, the specific steps are as follows:

[0049] Take about 10 5 ~2×10 5 Nasopharyngeal carcinoma cell line CNE1 was cultured in a 6-well plate in complete medium (RPMI 1640) containing 10% fetal bovine serum without antibiotics, at 37°C, 5% CO 2 Incubate overnight in an incubator, and start transfection the next day when the cell density reaches about 60%. Dilute lipofectamine 2000 with Opti-men medium, and dilute Epstein-Barr virus miR-BART10-5p and its inhibitors with Opti-men medium. After incubation at room temperature for 5 minutes, dilute lipofectamine 2000 with diluted EB virus miR-BART10- Mix 5p and its inhibitors, incubate at room temperature for 20min, remove the culture medium from the 6-well plate cells, wa...

experiment example 2

[0052] Experimental Example 2, Chicken Embryo Chorioallantoic Membrane Experiment

[0053] Clean the surface of SPF-grade fertilized eggs, soak them in 1:1000 bromogeramine for 3 minutes, wipe them dry, and place the eggs with the air chamber up in the ordinary incubator to incubate; on the 7th day of incubation, take the egg embryos and mark the air chamber and fetal position under the egg inspection lamp. And mark the fenestration site near the fetal position where there is no blood vessel. Disinfect the top of the air chamber and the mark with aner iodine, drill a small hole outside the top of the air chamber, then use a small hacksaw and ophthalmic tweezers to carefully peel off the 1x1 cm eggshell at the mark, and add a drop of sterile saline to the shell On the membrane, use a rubber nipple to suck through the small hole at the end of the air chamber to cause a negative pressure in the air chamber, the saline sinks, and an artificial false air chamber is formed, seal it ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses applications of an EB virus miR-BART10-5p inhibitor. According to the present invention, the analysis results of microtubule formation experiments and chick embryo chorioallantoie membrane experiments show that EB virus miR-BART10-5p highly expressed in nasopharyngeal carcinoma cells can significantly promote the neoangiogenesis of nasopharyngeal carcinoma; the antisense oligonucleotide of EB virus miR-BART10-5p is used as the base and is subjected to a series of modifications to obtain the EB virus miR-BART10-5p inhibitor; and the results of microtubule formation experiments, chick embryo chorioallantoie membrane experiments and matrigel plug experiments prove that the EB virus miR-BART10-5p inhibitor can significantly inhibit the neoangiogenesis of nasopharyngealcarcinoma, has nasopharyngeal carcinoma treatment effect, and can further be used for preventing and treating the recurrence and metastasis of nasopharyngeal carcinoma.

Description

technical field [0001] The invention belongs to the field of tumor molecular biology, and more specifically relates to the application of an Epstein-Barr virus miR-BART10-5p inhibitor. Background technique [0002] Nasopharyngeal carcinoma (nasopharyngeal carcinoma, NPC) refers to malignant tumors that occur in the nasopharyngeal mucosa. It occurs mostly in middle-aged people and occasionally in adolescents. It is highly malignant and has the highest recurrence and metastasis rates among head and neck tumors. Cervical lymph node metastasis can occur and the metastasis rate is as high as 80%. It often occurs in South China and Southeast Asia with obvious regional characteristics. Within 5 years after nasopharyngeal carcinoma patients are cured, 20-30% of patients still have recurrence and metastasis of nasopharyngeal carcinoma, which is one of the main factors leading to clinical death. At present, the main means of clinical treatment of nasopharyngeal carcinoma are surgery, ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): A61K31/7105A61P35/00A61P35/04A61P11/02A61P11/04
CPCA61K31/7105
Inventor李欣吕晓明王建国
OwnerSHENZHEN HOSPITAL OF SOUTHERN MEDICAL UNIV