Application of Epstein-Barr virus mir-bart10-5p inhibitor
An Epstein-Barr virus and inhibitor technology, applied in the field of EB virus miR-BART10-5p inhibitor, can solve the problems of damage to normal tissues and organs, increased cytotoxicity, and large irradiation volume, achieving reduced dosage, easy operation, and good treatment Effect
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0036] Embodiment 1, Epstein-Barr virus miR-BART10-5p, Epstein-Barr virus miR-BART10-5p antisense oligonucleotide, Epstein-Barr virus miR-BART10-5p inhibitor
[0037] (1) Epstein-Barr virus miR-BART10-5p
[0038] According to the international public sanger mirbase database, the sequence of Epstein-Barr virus miR-BART10-5p is as follows:
[0039] GCCACCUCUUUGGUUCUGUACA (SEQ ID NO: 1)
[0040] (2) Epstein-Barr virus miR-BART10-5p antisense oligonucleotide
[0041] The antisense design was carried out according to the sequence of Epstein-Barr virus miR-BART10-5p in the international public sanger mirbase database; wherein, the basic principles of probe design were: 1) there were no more than two hairpin structures inside the probe; The similarity between BLAST comparison and other sequences is less than 20%; 3) the repetition of BLAST comparison with other gene sequences is no more than 3 bases; the antisense oligonucleotide sequence is obtained as follows:
[0042] UGUACAGAA...
experiment example 1
[0047] Experimental Example 1, Microtubule Formation Experiment
[0048] Microtubule formation assay was used to detect the effect of Epstein-Barr virus miR-BART10-5p and its inhibitors on the microtubule formation of human umbilical vein endothelial cells HUVEC, the specific steps are as follows:
[0049] Take about 10 5 ~2×10 5 Nasopharyngeal carcinoma cell line CNE1 was cultured in a 6-well plate in complete medium (RPMI 1640) containing 10% fetal bovine serum without antibiotics, at 37°C, 5% CO 2 Incubate overnight in an incubator, and start transfection the next day when the cell density reaches about 60%. Dilute lipofectamine 2000 with Opti-men medium, and dilute Epstein-Barr virus miR-BART10-5p and its inhibitors with Opti-men medium. After incubation at room temperature for 5 minutes, dilute lipofectamine 2000 with diluted EB virus miR-BART10- Mix 5p and its inhibitors, incubate at room temperature for 20min, remove the culture medium from the 6-well plate cells, wa...
experiment example 2
[0052] Experimental Example 2, Chicken Embryo Chorioallantoic Membrane Experiment
[0053] Clean the surface of SPF-grade fertilized eggs, soak them in 1:1000 bromogeramine for 3 minutes, wipe them dry, and place the eggs with the air chamber up in the ordinary incubator to incubate; on the 7th day of incubation, take the egg embryos and mark the air chamber and fetal position under the egg inspection lamp. And mark the fenestration site near the fetal position where there is no blood vessel. Disinfect the top of the air chamber and the mark with aner iodine, drill a small hole outside the top of the air chamber, then use a small hacksaw and ophthalmic tweezers to carefully peel off the 1x1 cm eggshell at the mark, and add a drop of sterile saline to the shell On the membrane, use a rubber nipple to suck through the small hole at the end of the air chamber to cause a negative pressure in the air chamber, the saline sinks, and an artificial false air chamber is formed, seal it ...
PUM

Abstract
Description
Claims
Application Information

- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com