Check patentability & draft patents in minutes with Patsnap Eureka AI!

Anterograde monosynaptic transneuronal tracking system

A synaptic, single-stage technique used in neurobiology to solve problems such as ambiguity

Inactive Publication Date: 2017-03-22
WUHAN INST OF VIROLOGY CHINESE ACADEMY OF SCI
View PDF1 Cites 5 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] However, tools for viral tracing across multilevel synapses cause unavoidable ambiguities in determining direct or indirect projection targets

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Anterograde monosynaptic transneuronal tracking system
  • Anterograde monosynaptic transneuronal tracking system
  • Anterograde monosynaptic transneuronal tracking system

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0034] Cells and Cell Culture

[0035] VERO-E6 cells (VERO, ATCC #CRL-1586) were cultured in Dulbecco's medium (DMEM) containing 10% fetal bovine serum (FBS) and penicillin-streptomycin (100 units / mL penicillin and 100 μg / mL streptomycin , Gibco)).

[0036] Following conventional procedures, hippocampal neurons derived from mouse embryos were isolated and cultured [20,21]. Briefly, hippocampi were dissected from pups of C57BL / 6 mice at embryonic day 18.5 (E18.5), sectioned, and further digested with trypsin / DNase I at 37°C for 15 minutes. Isolated neurons were washed with sterile Hank's Balanced Salt Solution (HBSS), suspended and cultured in supplemented with 2% B27, glutamax (25 μm) and penicillin-streptomycin (100 units / ml and 100 μg / ml) ( GIBCO) neural basal medium. Change the medium every other day.

Embodiment 2

[0038] Build H129-G1

[0039] HSV-1-H129 genome (GenBank GU734772.1) is cloned on the bacterial artificial chromosome (BAC) that has green fluorescent protein gene, obtains H129-G1 (as figure 1 shown in b). as attached figure 1 As shown in (d) and (e), the specific main steps are as follows:

[0040] (2.1) Extract H129-wt virus genomic DNA

[0041] Infect VERO cells with wild-type H129-wt virus [22] at a multiplicity of infection of 1. After 12 hours of infection, scrape off the cells, collect the cell pellet by centrifugation, and use solution I (10mM Tris, 10mM EDTA, pH 8.0) solution Wash again, and then use 0.5ml solution I solution (comprising 0.25mg Proteinase K / ml (Roche company in the United States); 0.6% sodium dodecyl sulfate (SDS) (Sinopharm Group); final concentration is 1M sodium chloride ) to resuspend the cell pellet, incubate at 50°C for 2 hours, add RNase I (Japan TaKaRa Company) with a final concentration of 10 mg / ml and incubate at 37°C for 1 hour, and fi...

Embodiment 3

[0078] Construction of H129-△Tk-td

[0079] H129-△Tk-td was obtained based on homologous recombination of H129-BAC (H129-G1). figure 1 (c) shows the structural configuration of H129-ΔTk-td.

[0080] (3.1) Cassette construction

[0081]Cloning tdtomato into the vector pRK-zeo (SEQ ID NO 40) by PCR, digestion, ligation and transformation to construct Cassette CMVpromoter-tdtomato-Zeo R , the forward primer is F: gcgtcgacatggtgagcaagggcgaggag- (SEQ ID NO 41), and the reverse primer is R: cgggatccttacttgtacagctcgtccatg (SEQ ID NO 42). The total volume of the PCR reaction system (PrimeStar DNA Polymerase, TaKaRa Company) is 50 μl, including 10 μl 5×buffer, 4 μl dNTP, 1.5 μl forward primer, 1.5 μl reverse primer, 0.5 μl PrimeStar enzyme, 1 μl template, and 31.5 μl water . The amplification conditions are: 1) 95°C for 2min; 2) 98°C for 15s; 3) 55°C for 15s; 4) 72°C for 1m30s; 5) 72°C for 10min; Then, the PCR product was subjected to 1% agarose (Biowest, Spain) gel electrophoresi...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
diameteraaaaaaaaaa
Login to View More

Abstract

The invention provides an anterograde monosynaptic transneuronal virus tracing system, which is drawing a direct post-synaptic target of neuron of special type of a specific brain nucleus. The anterograde monosynaptic transneuronal virus tracing system comprises recombinant defective HSV-1 viruses derived from H129 and recombinant AAV9 helper viruses (AAV9-TK-GFP and AV9-DIO-TK-GFP), wherein the recombinant defective HSV-1 viruses comprise an integrated first expression cassette; the first expression cassette comprises a first promoter, a first fluorescent protein encoding sequence and a resistance peptide encoding sequence, wherein the first expression cassette completely or partially replaces the gene sequence of thymidine kinase (TK), and a TK function (H129-[delta]TK-tdT) becomes lost in the generated H129 derived recombinant defective HSV-1 H129 viruses; and the recombinant AAV9 helper viruses comprise an integrated second expression cassette; the second expression cassette comprises a second promoter, a TK encoding sequence, a connexon peptide encoding sequence and a second fluorescent protein encoding sequence, wherein through TK expression of the second expression cassette, the replication of the H129 derived recombinant defective HSV-1 viruses is achieved, wherein different fluorescent proteins are encoded by virtue of the first and the second fluorescent protein encoding sequences.

Description

technical field [0001] The present invention relates generally to neurobiology, and more particularly to an anterograde transmonosynaptic transneuronal tracing system. Background technique [0002] Mapping the brain's connectome is essential to understanding how the brain works. As the basic unit of neural function, neural circuits serve as bridges between macroscopic structure / function and micromolecular / signaling circuits. However, the architecture of many specific functional neural circuits, including components, connections and distributions, remains to be elucidated. New tracing techniques and tracing tools, especially virus tracing tools, help to discover new circuits and reveal new functions of known typical circuits. [0003] Viral tracer tools are already used in neuroscience research. Rabies virus (RV) and pseudorabies virus (PRV)-derived virus tracers have the ability to trace neural circuits to label input neural networks (1). Recombinant vesicular stomatitis...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N7/01
CPCC12N7/00C12N9/1211C12N2710/16621C12N2750/14121C12Y207/01021
Inventor 罗敏华曾文波江海飞赵非杨虹宋一舸谌章舟
Owner WUHAN INST OF VIROLOGY CHINESE ACADEMY OF SCI
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More