Anterograde monosynaptic transneuronal tracking system
A synaptic, single-stage technique used in neurobiology to solve problems such as ambiguity
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0034] Cells and Cell Culture
[0035] VERO-E6 cells (VERO, ATCC #CRL-1586) were cultured in Dulbecco's medium (DMEM) containing 10% fetal bovine serum (FBS) and penicillin-streptomycin (100 units / mL penicillin and 100 μg / mL streptomycin , Gibco)).
[0036] Following conventional procedures, hippocampal neurons derived from mouse embryos were isolated and cultured [20,21]. Briefly, hippocampi were dissected from pups of C57BL / 6 mice at embryonic day 18.5 (E18.5), sectioned, and further digested with trypsin / DNase I at 37°C for 15 minutes. Isolated neurons were washed with sterile Hank's Balanced Salt Solution (HBSS), suspended and cultured in supplemented with 2% B27, glutamax (25 μm) and penicillin-streptomycin (100 units / ml and 100 μg / ml) ( GIBCO) neural basal medium. Change the medium every other day.
Embodiment 2
[0038] Build H129-G1
[0039] HSV-1-H129 genome (GenBank GU734772.1) is cloned on the bacterial artificial chromosome (BAC) that has green fluorescent protein gene, obtains H129-G1 (as figure 1 shown in b). as attached figure 1 As shown in (d) and (e), the specific main steps are as follows:
[0040] (2.1) Extract H129-wt virus genomic DNA
[0041] Infect VERO cells with wild-type H129-wt virus [22] at a multiplicity of infection of 1. After 12 hours of infection, scrape off the cells, collect the cell pellet by centrifugation, and use solution I (10mM Tris, 10mM EDTA, pH 8.0) solution Wash again, and then use 0.5ml solution I solution (comprising 0.25mg Proteinase K / ml (Roche company in the United States); 0.6% sodium dodecyl sulfate (SDS) (Sinopharm Group); final concentration is 1M sodium chloride ) to resuspend the cell pellet, incubate at 50°C for 2 hours, add RNase I (Japan TaKaRa Company) with a final concentration of 10 mg / ml and incubate at 37°C for 1 hour, and fi...
Embodiment 3
[0078] Construction of H129-△Tk-td
[0079] H129-△Tk-td was obtained based on homologous recombination of H129-BAC (H129-G1). figure 1 (c) shows the structural configuration of H129-ΔTk-td.
[0080] (3.1) Cassette construction
[0081]Cloning tdtomato into the vector pRK-zeo (SEQ ID NO 40) by PCR, digestion, ligation and transformation to construct Cassette CMVpromoter-tdtomato-Zeo R , the forward primer is F: gcgtcgacatggtgagcaagggcgaggag- (SEQ ID NO 41), and the reverse primer is R: cgggatccttacttgtacagctcgtccatg (SEQ ID NO 42). The total volume of the PCR reaction system (PrimeStar DNA Polymerase, TaKaRa Company) is 50 μl, including 10 μl 5×buffer, 4 μl dNTP, 1.5 μl forward primer, 1.5 μl reverse primer, 0.5 μl PrimeStar enzyme, 1 μl template, and 31.5 μl water . The amplification conditions are: 1) 95°C for 2min; 2) 98°C for 15s; 3) 55°C for 15s; 4) 72°C for 1m30s; 5) 72°C for 10min; Then, the PCR product was subjected to 1% agarose (Biowest, Spain) gel electrophoresi...
PUM
Property | Measurement | Unit |
---|---|---|
diameter | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information

- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com