Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Preparation method and applications of porcine circovirus type II recombinant lactobacillus plantarum oral vaccine

A technology of porcine circovirus and plantarum lactobacillus, which is applied in the field of preparation of porcine circovirus type 2 recombinant lactobacillus plantarum oral vaccine, can solve the problems of long time, high price, inability to use emergency vaccination, etc., and achieve high expression level , to express a stable effect

Inactive Publication Date: 2017-03-22
GUANGZHOU WELLTECH BIOTECH CO LTD
View PDF2 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The main strains of inactivated vaccines are divided into: SH strain, LG strain, WH strain, and ZJ / c strain; inactivated vaccines need to be inoculated multiple times during use, and it takes a long time to produce immune protection, and cannot be used for emergency prevention inoculation
Commercialized genetically engineered vaccines are mainly imported Boehringer vaccines, which have remarkable protective effects but are expensive

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Preparation method and applications of porcine circovirus type II recombinant lactobacillus plantarum oral vaccine
  • Preparation method and applications of porcine circovirus type II recombinant lactobacillus plantarum oral vaccine
  • Preparation method and applications of porcine circovirus type II recombinant lactobacillus plantarum oral vaccine

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0038] Example 1 Cloning of circovirus

[0039] DNA virus extraction kit was used to extract the genome from the disease materials collected from pig farms, and two pairs of primers were designed. By PCR, positive samples were detected from the collected disease materials with primers P1 and P2, and then P3, P4 amplifies the sequence of the whole virus of PCV2:

[0040] Primer P1: AATGGCATCTTCAACACCC

[0041] Primer P2: TTAAGGGTTAAGTGGGGGGTC

[0042] Primer P3: CCCAAGCTTCCGCGGGCTGGCTGATTTGAAAGT

[0043] Primer P4: GGGGTACCCCGCGGAAATTTCTGACAAACGTTAC

[0044] The specific process is as follows:

[0045] S1. Using the genome extracted from the disease material as a template, use primers P1 and P2 to detect virus specificity. The PCR program is: pre-denaturation, 94°C for 5 minutes; denaturation, 94°C for 45s; annealing, 55°C for 30s; extension , 72°C for 30s; after 30 cycles, the final extension was 10min at 72°C. After electrophoresis, the sample that could amplify a band o...

Embodiment 2

[0048] Example 2 Construction of Lactobacillus plantarum expression vector

[0049] Design a pair of primers (P6 and P5) to amplify the sequence of ORF2 reading frame (Cap protein)

[0050] P5: CCCTCGAGATGATGACGTATCCAAGGAGGCGTTTC

[0051] P6: CCGAGCTCTTACTTAGGGTTAAGTGGGGGGTCTTTAAG

[0052] Construction of recombinant Lactobacillus expression vector: (1) Using the plasmid pMD19-PCV2 as a template and P5 and P6 as primers, the sequence of the Cap protein of PCV2 was amplified with high-fidelity enzymes. The PCR program was: pre-denaturation, 94°C for 5 minutes ; Denaturation, 94°C 45s; Annealing, 54°C 30s; Extension, 72°C 2min; After 30 cycles, 72°C final extension 10min after electrophoresis identification, a band of about 700bp was amplified.

[0053] (2) After the band of about 700bp is purified and recovered, it is connected to the pPSCPSP vector: the product after PCR amplification is recovered by 1% agarose gel electrophoresis and used together with the expression vector...

Embodiment 3

[0055] Example 3 Expression and identification of protein

[0056] 1. The expression of the target gene in Lactobacillus plantarum and the SDS-PAGE identification of the expression product: the transformed positive recombinant bacteria pPSCPSP-Cap-LP-1 and the empty vector pPSCPSP-LP-1 were cultured in MRS liquid medium Overnight, inoculate the bacterial solution after overnight cultivation into an appropriate amount of MRS solution at a ratio of 2%, culture at 37°C for about 28 hours, take the supernatant, precipitate with 80% ammonium sulfate, refold the protein with PBS, concentrate and treat it with 12 % of the separated protein gel electrophoresis, and the corresponding protein bands were detected by SDS-PAGE protein electrophoresis ( image 3 ), image 3 The results showed that the empty plasmid group had no target band, and the recombinant Lactobacillus plantarum group had a target band of about 28 kDa.

[0057] 2. The expression of the target gene in Lactobacillus pl...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a preparation method of porcine circovirus type II recombinant lactobacillus plantarum. The preparation method comprises following steps: separated Cap sequence is connected with expression vector pPSCPSP so as to construct expression plasmid pPSCPSP-Cap; expression plasmid pPSCPSP-Cap is inserted into lactobacillus plantarum LP-1 so as to obtain porcine circovirus recombinant lactobacillus plantarum pPSCPSP-Cap-LP-1; a cultured product of pPSCPSP-Cap-LP-1 can be applied directly as an oral vaccine to stimulate bodies to generate antibodies effectively, and reduce the morbidity of porcine circovirus type II obviously. Application of the oral vaccine is beneficial for avoiding of retarded growth, emaciation, sow reproduction disorder, dyspnea, occasionally induced jaundice, diarrhea, extensive pathological changes of visceral organs and skin caused by serious infection of porcine circovirus in livestock breeding, improving of pig herd immunity and health conditions, and increasing of the economic benefit of breeding.

Description

technical field [0001] The invention relates to the technical field of vaccine preparation, in particular to a preparation method and application of porcine circovirus type 2 recombinant Lactobacillus plantarum oral vaccine. Background technique [0002] Porcine circovirus (Porcine circovirus, PCV) belongs to Circovridae (Circovridae) Circovirus (Circovirus), serotypes are PCV1 and PCV2, clinically the main cause of disease is PCV2. Circovirus infection mainly causes multisystemic wasting syndrome (PMWS) in weaned piglets, which is also closely related to many other syndromes, such as porcine congenital tremor (CT), dermatitis nephrotic syndrome (PNDS), porcine respiratory disease syndrome, sow reproductive failure and enteritis. PCV2 is often associated with porcine reproductive and respiratory syndrome virus (PRRSV) or porcine parvovirus (PPV) or secondary infection of bacteria, which makes the sick pigs aggravated and causes great economic losses to the pig industry all ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/74C12N1/21A61K39/12A61P31/20C12R1/25
Inventor 赖强倪能能钟泽民华国良刘德辉
Owner GUANGZHOU WELLTECH BIOTECH CO LTD
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products