Carbonyl reductase, mutant and application thereof in preparation of antifungal drug intermediates

A technology of carbonyl reductase and amino acid, applied in the direction of oxidoreductase, application, enzyme, etc., can solve the problems of poor substrate tolerance, low production efficiency, low substrate tolerance concentration, etc.

Active Publication Date: 2017-05-24
EAST CHINA UNIV OF SCI & TECH +1
View PDF8 Cites 11 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Gotor et al. screened a variety of alcohol dehydrogenases (ADH-T, ADH-CP, ADH-A, etc.), but only ADH-T has good activity and enantioselectivity among many enzymes, but the enzyme base Poor drug tolerance, the highest substrate concentration is only 6.7g / L (J.Org.Chem.2011,76,2115-2122.)
[0006] In summary, in the synthesis of optically pure (R)-2-chloro-1-(2',4'-difluorophenyl)ethanol, (R)-2-bromo-1-(2,4-dichloro Phenyl) ethanol, (R)-2-chloro-1-(2', 4'-dichlorophenyl) ethanol and other antifungal imidazole drug synthesis intermediates have many deficiencies, known Reductase has problems such as low catalytic activity, low substrate tolerance concentration and low production efficiency.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Carbonyl reductase, mutant and application thereof in preparation of antifungal drug intermediates
  • Carbonyl reductase, mutant and application thereof in preparation of antifungal drug intermediates
  • Carbonyl reductase, mutant and application thereof in preparation of antifungal drug intermediates

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0085] Example 1 Gene Cloning of Carbonyl Reductase SsCR

[0086] According to the open reading frame of carbonyl reductase SsCR, design upstream and downstream primers as follows:

[0087] Upstream primer SEQ ID No.3:

[0088] CCG GAATTC ATGACTACCTCAGTTTTCGT

[0089] Downstream primer SEQ ID No.4:

[0090] CCG CTCGAG TTAACCTTGTACCTTTCAAAA

[0091] Wherein, the underlined part of the upstream primer is the EcoR I restriction site, and the underlined part of the downstream primer is the Xho I restriction site.

[0092] The genomic DNA of xylose fermenting yeast CBS 6054 was used as a template for PCR amplification. PCR system: 2×TaqPCR MasterMix 25μl, upstream primer and downstream primer (10ng / μl) each 2.5μl, genomic DNA (100ng / μl) 1μl and ddH 2 O 19 μl. The PCR amplification program was: 95°C pre-denaturation for 5 minutes followed by 32 cycles of the following: denaturation at 94°C for 30 seconds, annealing at 50°C for 40 seconds, extension at 72°C for 1 minute, ...

Embodiment 2

[0093] Example 2 Preparation of Carbonyl Reductase Recombinant Expression Plasmid and Recombinant Expression Transformant

[0094] Such as figure 1 As shown, the carbonyl reductase target fragment obtained by PCR amplification in Example 1 and pET 28a empty plasmid were double-digested overnight with restriction endonucleases EcoR I and Xho I, then purified by agarose gel electrophoresis, and the DNA Kit recovery. The recovered target fragment and the empty plasmid vector were ligated under the action of T4 DNA ligase at 4°C for 12 hours to obtain the recombinant plasmid pET28a-SsCR.

[0095] Transform the resulting recombinant plasmid into E.coli DH 5α, spread it on an LB medium plate containing 50 μg / ml kanamycin, incubate at 37°C for 8 hours, perform colony PCR verification on the grown colonies, and pick colony PCR Positive clones with a target band of about 1000 bp in length were amplified. After verification by sequencing, the corresponding plasmids were extracted, fu...

Embodiment 3

[0096] Example 3 Carbonyl reductase SsCR mutant construction

[0097] The random mutation library of carbonyl reductase SsCR was constructed by error-prone PCR technique: pET28a_SsCR was used as template, For_EcoR I and Rev_Xho I were used as primers, and Taq DNA polymerase was used for error-prone PCR. To obtain a suitable mutation rate, a series of different MnCl 2 Concentration gradient (100μM~300μM MnCl 2 ) to build a mutation library. The PCR reaction conditions are as follows: in a PCR reaction system with a total volume of 50 μL, add 0.5-20 ng of template, 5 μL of 10×PCR buffer (Mg 2+ Plus), 5 μL dNTPs (2.0 mM each), 5 μL MnCl 2 (1mM), 2μL (10μM) of each pair of mutant primers, 0.5μL Taq DNApolymerase, add sterilized distilled water to 50μL. PCR reaction program: (1) denaturation at 95°C for 3 min; (2) denaturation at 94°C for 10 sec, (3) annealing at 60°C for 30 sec, (4) extension at 72°C for 90 sec, steps (2) to (4) were performed for 30 cycles in total, Finally,...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to carbonyl reductase, a mutant and application thereof in preparation of antifungal drug intermediates. The invention specifically discloses xylose fermentation yeast carbonyl reductase and a mutant with improved activity thereof, encoding genes and amino acid sequences, recombinant expression vectors and recombinant expression transformants containing the gene sequences, as well as application of catalyzing asymmetric reduction of prochiral carbonyl compounds by taking the xylose fermentation yeast carbonyl reductase or corresponding recombinant expression transformants as catalysts, particularly catalyzing reduction of 2-chloro-2',4'-difluoroacetophenone and 2,2',4'-trichloroacetophenone for preparing antifungal compound precursors (R)-2-chloro-1-(2',4'-difluorophenyl)ethanol and (R)-2-chloro-1-(2',4'-dichlorophenyl)ethanol. Compared with the existing other asymmetric reduction methods, the method disclosed by the invention has the advantages of high enzymatic reaction substrate concentration, mild reaction condition, environment friendliness, high yield, high optical purity of products and the like and has excellent application prospects.

Description

technical field [0001] The invention belongs to the technical field of bioengineering, and in particular relates to a carbonyl reductase of xylose fermenting yeast and a mutant with improved catalytic performance, the coding gene and amino acid sequence of the carbonyl reductase and its mutant, including the recombinant expression of the coding gene Vector and recombinant expression transformant, and use the carbonyl reductase or recombinant expression transformant to catalyze the asymmetric reduction of latent chiral carbonyl compounds to prepare optically pure chiral alcohols, especially to catalyze 2-chloro-2',4-difluorobenzene Asymmetric Reduction of Ethanone and 2,2',4'-Trichloroacetophenone to Prepare Optically Pure Antifungal Drug Intermediate (R)-2-Chloro-1-(2',4'-Difluorophenyl ) ethanol and (R)-2-chloro-1-(2',4'-dichlorophenyl)ethanol. Background technique [0002] (R)-2-Chloro-1-(2',4'-difluorophenyl)ethanol and (R)-2-chloro-1-(2',4'-dichlorophenyl)ethanol are sy...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N9/04C12N15/53C12P7/22C12P7/02
CPCC12N9/0006C12P7/02C12P7/22C12Y101/01184
Inventor郁惠蕾商曰朋潘江许建和钱小龙
OwnerEAST CHINA UNIV OF SCI & TECH