Aptamer electrochemistry biosensor capable of detecting malachite green and preparation method thereof
A biosensor, malachite green technology, applied in the field of biosensors, can solve the problems of easy false positives in detection results, reduce costs, etc., and achieve the effect of simple preparation procedures and detection methods, wide linear range and rapid detection
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0027] An aptamer electrochemical biosensor for detecting malachite green, including a recognition element and a transducer; the recognition element is a single-stranded DNA aptamer with a sequence of GGATCCCGACTGGCGAGAGCCAGGTAACGAATGGATCC, containing 38 bases, and the 5' end is modified-SH- (CH 2 ) 6 ‐, the electroactive substance methylene blue (MB) is modified at the 3' end as a beacon molecule; the transducer is a commonly used electrochemical transducer, and the working electrode is a gold electrode modified with the above-mentioned malachite green single-stranded DNA aptamer , the counter electrode is Pt, the reference electrode is Ag / AgCl; the detection bottom solution is phosphate buffer solution.
[0028] A method for preparing an aptamer electrochemical biosensor for detecting malachite green, comprising the following steps:
[0029] (1) Polish the gold electrode on a polishing cloth with 0.05 μm alumina powder for 2 minutes, ultrasonically clean it three times wit...
Embodiment 2
[0037] An aptamer electrochemical biosensor for detecting malachite green, including a recognition element and a transducer; the recognition element is a single-stranded DNA aptamer with a sequence of GGATCCCGACTGGCGAGAGCCAGGTAACGAATGGATCC, containing 38 bases, and the 5' end is modified-SH- (CH 2 ) 6 ‐, the electroactive substance methylene blue (MB) is modified at the 3' end as a beacon molecule; the transducer is a commonly used electrochemical transducer, and the working electrode is a gold electrode modified with the above-mentioned malachite green single-stranded DNA aptamer , the counter electrode is Pt, the reference electrode is Ag / AgCl; the detection bottom solution is phosphate buffer solution.
[0038] A method for preparing an aptamer electrochemical biosensor for detecting malachite green, comprising the following steps:
[0039] (1) Polish the gold electrode on a polishing cloth with 0.05 μm alumina powder for 2 minutes, ultrasonically clean it three times wit...
Embodiment 3
[0046] An aptamer electrochemical biosensor for detecting malachite green, including a recognition element and a transducer; the recognition element is a single-stranded DNA aptamer with a sequence of GGATCCCGACTGGCGAGAGCCAGGTAACGAATGGATCC, containing 38 bases, and the 5' end is modified-SH- (CH 2 ) 6 ‐, the electroactive substance methylene blue (MB) is modified at the 3' end as a beacon molecule; the transducer is a commonly used electrochemical transducer, and the working electrode is a gold electrode modified with the above-mentioned malachite green single-stranded DNA aptamer , the counter electrode is Pt, the reference electrode is Ag / AgCl; the detection bottom solution is phosphate buffer solution.
[0047] A method for preparing an aptamer electrochemical biosensor for detecting malachite green, comprising the following steps:
[0048] (1) Polish the gold electrode on a polishing cloth with 0.05 μm alumina powder for 2 minutes, ultrasonically clean it three times wit...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


