A mutant taq enzyme capable of improving the efficiency of adding a and its preparation method and application

A mutation-type, high-efficiency technology, applied in the biological field, can solve the problem of low efficiency of adding A, and achieve the effect of improving the efficiency of adding A, increasing the efficiency of library construction, and increasing the integrity and coverage of library construction

Active Publication Date: 2019-03-19
VAZYME BIOTECH NANJING
View PDF4 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] The purpose of the present invention is to provide a mutant Taq enzyme that can improve the efficiency of adding A and its preparation method and application, which overcomes the defect of low efficiency of adding A to the end of DNA fragments in the existing high-throughput sequencing technology, and obtains an amino acid sequence such as The mutant Taq enzyme shown in SEQ NO.1, the efficiency of adding A to this mutant Taq enzyme is greatly improved, and is more suitable for the needs of high-throughput sequencing library construction

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A mutant taq enzyme capable of improving the efficiency of adding a and its preparation method and application
  • A mutant taq enzyme capable of improving the efficiency of adding a and its preparation method and application
  • A mutant taq enzyme capable of improving the efficiency of adding a and its preparation method and application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0041] Embodiment 1 constructs the vector containing the nucleotide sequence of coding mutant Taq enzyme

[0042] Using the method of gene synthesis, the synthetic primer sequence is as follows:

[0043] E315K-1: TTCCCGCAAGAAAGCCCATGTGGGCCGATCTTCTG;

[0044] E315K-2: CCCACATGGGCTTCTTGCGGGAAAGCACAAAGCC;

[0045] E388V-1: CACCACCCCCGTGGGGGTGGCCCGGCGCTACGGC;

[0046] E388V-2: GGGCCACCCCCACGGGGGTGGTGTTGGAAGGGTC;

[0047] E507K-1: CGGCAAGACGAAGAAGACCGGCAAGCGCTCCACC;

[0048] E507K-2: TGCCGGTCTTCTTCGTCTTGCCGATGGCGGGAAG;

[0049] D578G-1: AAGTAGCTCCGGCCCCAACCTCCAGAACATCCCC;

[0050] D578G-2: GGAGGTTGGGGCCGGAGCTACTTAGCCTGCCCGT;

[0051] A608V-1: GCTATTGGTGGTGCTGGACTATAGCCAGATAGAG;

[0052] A608V-2: TATAGTCCAGCACCACCAATAGCCACCCCTCCTC;

[0053] M747R-1: GGCCGAGCGCCGCGCCTTCAACATGCCCGTCCAGG;

[0054] M747R-2: TGTTGAAGGCGCGGCGCTCGGCCGCCTCCCGCAC;

[0055] Using the plasmid containing the wild-type Taq gene sequence as a template, PCR is used to amplify the wild-type Taq gene. The P...

Embodiment 2

[0058] Example 2 Transforming the host cell with the vector to obtain a recombinant cell:

[0059] Take 10 ng of the vector verified by sequencing and transform it into BL21 competent cells by the same transformation method, spread it on the LB plate containing ampicillin, and culture overnight at 37°C. Single clones were picked the next day.

Embodiment 3

[0060] Example 3 Cultivate and collect recombinant cells, extract and purify mutant Taq enzyme

[0061] Pick the monoclonal recombinant cells into 3ml LB liquid medium, shake and cultivate for 6-8h, then transfer and expand into 300ml LB liquid medium, shake for 4-6h, add IPTG to the final concentration of 50mmol / L Continue to shake overnight to induce the expression of the target protein. Dispense 300ml of bacterial liquid into 50ml centrifuge tubes, and collect bacterial cells by centrifugation at 5000rpm for 10min. Add 10ml of elution buffer (50mmol / L Tris-HCl pH7.9; 50mmol / L dextrose; 1mmol / LEDTA) to resuspend each 100ml of bacterial liquid after centrifugation, place on ice for 1h; centrifuge at 3500rpm for 3min to re-collect the bacteria. Add 50ml pre-lysis buffer (elution buffer plus 4g / L lysozyme), let stand at room temperature for 15min; add 50ml lysis buffer (10mmol / L Tris-HCl pH7.9; 50mmol / L KCl; 1mmol / L EDTA; 1mmol / L PMSF; 0.5% Tween-20 (V / V); 0.5% NP-40 (V / V)),...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention discloses mutant type Taq enzyme capable of improving the A adding efficiency as well as a preparation method and application of the mutant type Taq enzyme. The preparation method comprises the following specific steps: directionally mutating wild type Taq enzyme, and mutating 315th glutamic acid into lysine; mutating 388th glutamic acid into valine, mutating 507th glutamic acid into the lysine, mutating 578th aspartic acid into glycine, mutating 608th alanine into the valine, and mutating 747th methionine into arginine to obtain the mutant type Taq enzyme with the amino acid sequence shown as SEQ NO.1. The A adding efficiency of the mutant type Taq enzyme is improved, and the database building efficiency is improved; the mutant type Taq enzyme can be applied to a template with lower initial amount, and the completeness and the cover degree of building the database are improved.

Description

technical field [0001] The invention belongs to the field of biotechnology, and in particular relates to a mutant Taq enzyme capable of improving A addition efficiency, a preparation method and application thereof. Background technique [0002] DNA polymerase is a class of enzymes that use single-stranded DNA as a template to synthesize its complementary strand. Like other enzymes derived from the natural environment, DNA polymerases have adapted to the environment in which they function and have corresponding optimal reaction conditions during evolution. DNA polymerases from different sources have different properties and functions. In addition to polymerase activity, most of them also contain exonuclease activity (3'-5' exonuclease activity or 5'-3' exonuclease activity) , the most commonly used of which is the thermostable Taq enzyme from an aquatic thermophile (Thermus aquaticus). Taq DNA polymerase belongs to the DNA polymerase I family, has polymerase and 5'-3' exonu...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Patents(China)
IPC IPC(8): C12N9/12C12N15/54C12N15/63C12Q1/6869
CPCC12N9/1252C12Q1/6869C12Y207/07007C12Q2535/122C12Q2521/101
Inventor 曹林张力军聂俊伟韩锦雄齐心瞿志鹏张晨曦徐晓昱
Owner VAZYME BIOTECH NANJING
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap