Unlock instant, AI-driven research and patent intelligence for your innovation.

A sarna that activates ptpro gene expression and its transporter

A gene expression and carrier technology, applied in the field of saRNA, can solve the problems of ineffective siRNA, patient suffering, off-target of targeted drugs, etc., and achieve easy surface functional modification, strong cell adhesion, and good biocompatibility. Effect

Active Publication Date: 2020-08-21
张灏
View PDF5 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0016] 1. Targeting a single target is often not enough to curb the progression of tumors, especially for relapsed and multidrug-resistant cancer patients. In clinical practice, only drugs that combine different pathways and mechanisms of action can be used to block signal transduction, multi-target, Inhibit tumor growth, which undoubtedly brings great pain and heavy economic burden to patients
[0017] 2. The siPTPRO technology is easy to degrade and cannot stably and effectively introduce siRNA into cells.
The biggest obstacle in the application of RNA interference technology is that its mechanism of action is a post-transcriptional regulation mechanism, and its action time is unstable
[0018] 3. Targeted drugs are prone to off-target and cause serious clinical side effects

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A sarna that activates ptpro gene expression and its transporter
  • A sarna that activates ptpro gene expression and its transporter
  • A sarna that activates ptpro gene expression and its transporter

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0049] Example 1: Western blot analysis of the expression levels of PTPRO gene protein in drug-resistant strains and parental strains

[0050] The cells were washed with PBS buffer, lysed with RIPA protein lysate on ice for several minutes, centrifuged at 12000rpm / min for 15min, the supernatant was collected, and the protein concentration was detected by BCA method. After 12.5% ​​SDS-PAG gel electrophoresis for about 2 hours, the protein was transferred to PVDF membrane. Block with 5% skim milk powder, add PTPRO monoclonal antibody (diluted 1:500 from Sigamg Company) and incubate overnight at 4°C. The fluorescent secondary antibody was diluted 1:2000 and incubated at room temperature for 2 hours. Chemiluminescence, developing, and fixing to obtain the target protein band results, rinse with running water and dry, and scan for later use. The result is as figure 1 As shown, PTPRO was lowly expressed in drug-resistant strains SKBR3-pool2 and BT474-HR20, suggesting that the exp...

Embodiment 2

[0052] Design of saRNA molecules targeting PTPRO gene and comparison of activation effects.

[0053] 1. Design of saRNA

[0054] The sequence of the PTPRO promoter region was obtained at the website NCBI (http: / / www.ncbi.nlm.nih.gov / ).

[0055] According to the design principle of RNAa sequence, 5 pairs of double-stranded small RNA activation sequences of PTPRO were designed and obtained, and the 5 pairs of sequences corresponded to the PTPRO promoter site. The sequence (SEQ ID NO: 1) of the PTPRO promoter region from the -3000 site to the -1 site is as follows:

[0056]TGATTTGGAGTCTTGAAAATAGCATAATAAGATTTATCATACTTTGGAAGTATTGTATTGAAAAACCAGTCAATAGCTCAAAGAAACACAAAACATGCTCTATGAATTGAAAACCCCACACTGTGGATGACACAGCATTCACATTCTTTATGAGAATCTCTTCTAGGACACTGTTATGGTTTAAGTGCAATAAAAACAAATGAAAGTATTTTATCCAGCAATAGCAATGTAAAATACTTTTCTCTAGAGAGGAAATTTTCTGTGATTATAAAATAATACTTTCAGTCTTCAGCCCATCTAACCACAATGTTACTAATAAAATAACAACAATGCCAATTACTAATGCTTTACTACTTACTGTTTACTGTTATTGTTCCTCCAAAGTGGTCCACATAATATATATATATATATAT...

Embodiment 3

[0100] Example 3: Cell experiments verify that PTPRO gene can improve drug sensitivity.

[0101] Such as Image 6 As shown, HER2-positive breast cancer cell lines are treated with trastuzumab and the drug sensitivity of breast cancer cells is improved by corresponding application of the present invention, and the activity experiment (MTT experiment) of cells after detection is processed. The MTT experiment proves that PTPRO and Hertz The results show that after overexpression of the PTPRO gene, the sensitivity of cancer cells to drugs increases, and the cell proliferation activity is weakened.

[0102] Implementation steps: the breast cancer cell line SKBR3 was inoculated on a 6-well plate, transfected with lipotectamine3000 as the transfection agent, and the final concentration of saPTPRO-220 was 50nmol / L, and overexpressed, and the control group was not treated. On the next day, the experimental group and the control group were divided into 3×10 4 cells / ml inoculated in 96...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
particle sizeaaaaaaaaaa
Login to View More

Abstract

The invention provides saRNA for activating PTPRO gene expression. The saRNA comprises a sequence which is complementary with a region from -3000 site to -200 site of a PTPRO gene promoter region. The saRNA disclosed by the invention can activate the PTPRO gene expression, through improving the expression or the activity of PTPRO genes namely drug sensitive genes, the drug sensitivity is improved, and the growth of tumor cells is restrained, so that the purpose of killing the tumor cells is realized, and tumors are treated. The invention further provides a transport carrier loaded with the saRNA. Functional modification is performed on the surface of the transport carrier through a modifier, and the transport carrier which can recognize the tumor cells and has good biocompatibility is constructed, so that the saRNA can safely and efficiently penetrate through cell membranes and / or cell nucleuses of the tumor cells.

Description

technical field [0001] The present invention relates to a saRNA, in particular to a saRNA for activating PTPRO gene expression. Background technique [0002] Cancer is the main killer of human health. Chemotherapy and targeted drugs, as important means of tumor treatment, play an irreplaceable role in clinical practice. However, the emergence of chemotherapy and targeted drug resistance has greatly reduced the therapeutic effect on tumors, leading to cancer recurrence and metastasis, which is the main cause of tumor death. [0003] In the past 30 years, the basic research of tumors has made great progress, especially understanding the occurrence and development of malignant tumors from the molecular level, which has created conditions for the prevention and treatment of tumors. Various new diagnosis and treatment methods and drugs emerge in an endless stream, but the therapeutic effect of malignant tumors has not been improved simultaneously. The prognosis of most malignan...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N15/113A61K48/00A61K31/713A61K39/395A61P35/00
CPCA61K39/39558A61K48/005C12N15/113C12N2310/141A61K2300/00
Inventor 张灏
Owner 张灏
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More