IL-2 and IFNgamma protein co-expressed eukaryotic expression system and preparation method and application thereof

An expression system and technology of γ protein, applied in chemical instruments and methods, botany equipment and methods, biochemical equipment and methods, etc., can solve problems such as difficult specific and efficient targeted regulation, and achieve the convenience of cellular immune function induction, The effect of reducing dosage

Inactive Publication Date: 2017-07-07
THE FIRST AFFILIATED HOSPITAL OF SUN YAT SEN UNIV
View PDF5 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the current IFNγ injection therapy in vivo can only achieve a non-specific increase in the level of IFNγ protein in patients, and it is difficult to achieve specific and efficient targeted regulation of the IFNγ level in the tumor microenvironment [Konjevic G, Radenkovic S, Srdic T, Jurisic V, Stamatovic Lj,Milovic M.Association of decreased NK cell activity and IFNγexpression with pSTAT dysregulation in breast cancer patients.J BUON.2011 Apr-Jun;16(2):219-26.]

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • IL-2 and IFNgamma protein co-expressed eukaryotic expression system and preparation method and application thereof
  • IL-2 and IFNgamma protein co-expressed eukaryotic expression system and preparation method and application thereof
  • IL-2 and IFNgamma protein co-expressed eukaryotic expression system and preparation method and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0036] Example 1 Construction of plasmids

[0037] Step 1. Obtain gene fragments containing specific restriction sites

[0038] After DNAworks design, the chemically synthesized oligonucleotide single-stranded mixture was used as a template (the chemical synthesis method used solid-phase phosphoramidite triester method, reference Pon, R.T. Solid-phase supports for oligonucleotide synthesis. Methods in Molecular Biology (Totowa , NJ, United States) (1993), 20 (Protocols for Oligonucleotides and Analogs), 465–496), the size is 987bp, and the specific primers are designed as follows:

[0039] Upstream primer (shown as SEQ ID NO:2):

[0040] GACACGCTAGCATGTACAGGATGCAACTCCTGTCTTG

[0041] Downstream primer (shown as SEQ ID NO:3):

[0042] GACACGGATCCTTACTGGGATGCTCTTCGACC

[0043] Under the action of the above-mentioned upstream and downstream primers containing specific restriction sites, pfu polymerase is used to amplify through PCR reaction to obtain the first round of PCR pr...

Embodiment 2

[0067] Example 2 Expression of target protein in liver cancer cells:

[0068] HepG2 human liver cancer cells were digested with 0.05% trypsin working solution for 5 minutes to detach the wall, then gently pipetted, dispersed into a single cell suspension and counted. at 0.5×10 6 The number of cells per well, cultured in DMEM high-glucose medium containing 10% fetal bovine serum at 37°C, 5% CO 2 and a constant temperature incubator with a relative humidity of 95%. When the confluency of the cells reaches 50%, discard the culture medium and gently wash the cells with PBS for 3 times to prepare for transfection.

[0069] Dilute 2 μg of pIRES2-EGFP-IL-2-IFNγ eukaryotic expression system and pIRES2 plasmid vector in 0.1mL Opti- In Medium, place at 20°C for 10 minutes. Meanwhile, dilute 10 μL of Lipofection2000 transfection reagent in 0.1 mL Opti- In Medium, place at 20°C for 10 minutes. The diluted two kinds of plasmid systems and the diluted Lipofection2000 transfection reag...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

PropertyMeasurementUnit
molecular weightaaaaaaaaaa
Login to view more

Abstract

The invention provides an IL-2 and IFNgamma protein co-expressed eukaryotic expression system and a preparation method and application thereof and belongs to the technical field of biological genes. The eukaryotic expression system comprises the nucleotide sequence of an IL-2 gene and the nucleotide sequence of an IFNgamma gene at the same time, the IL-2 gene and the IFNgamma gene are loaded through a carrier, IL-2 protein and IFNgamma protein can be expressed at the same through the same eukaryotic expression system, the use quantity of the gene carrier can be reduced, introduction of non-treatment related exogenous gene sequences is reduced, and the proportion of the IL-2 protein acting on a focus to the IFNgamma protein acting on the focus is controlled. The eukaryotic expression system can be used for immunologic function regulation and control and gene immunotherapy of cells, the immune regulation effect of cell factors can be exerted, and an atopic treatment effect can be generated on tumor cells and other target cells.

Description

technical field [0001] The invention belongs to the technical field of biological genes, and specifically relates to a eukaryotic expression system and its preparation method and application, in particular to a eukaryotic expression system for co-expression of IL-2 and IFNγ protein, its preparation method and application. Background technique [0002] Interleukin-2 (Interleukin-2, IL-2), also known as T cell growth factor (T Cell Growth Factor, TCRF). IL-2 is a cytokine that plays an important regulatory role in the body's immune response and is produced by T lymphocytes or T lymphocyte lines under the stimulation of mitogens or specific antigens. IL-2 is the core substance in the human immune regulation network, and it has synergistic and antagonistic effects with other immune-related cytokines to jointly complete the regulation of human immune function; it can stimulate the activation and proliferation of NK, CTL, LAK and other cells, and also It can promote T lymphocytes...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/79C12N15/66C12N15/23C12N15/26A61K48/00A61P35/00
CPCC12N15/79A61K48/005C07K14/55C07K14/57C12N15/66
Inventor 郭宇匡铭彭穗王晶赵坤彭振伟
Owner THE FIRST AFFILIATED HOSPITAL OF SUN YAT SEN UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap