IL-2 and IFNgamma protein co-expressed eukaryotic expression system and preparation method and application thereof
An expression system and technology of γ protein, applied in chemical instruments and methods, botany equipment and methods, biochemical equipment and methods, etc., can solve problems such as difficult specific and efficient targeted regulation, and achieve the convenience of cellular immune function induction, The effect of reducing dosage
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0036] Example 1 Construction of plasmids
[0037] Step 1. Obtain gene fragments containing specific restriction sites
[0038] After DNAworks design, the chemically synthesized oligonucleotide single-stranded mixture was used as a template (the chemical synthesis method used solid-phase phosphoramidite triester method, reference Pon, R.T. Solid-phase supports for oligonucleotide synthesis. Methods in Molecular Biology (Totowa , NJ, United States) (1993), 20 (Protocols for Oligonucleotides and Analogs), 465–496), the size is 987bp, and the specific primers are designed as follows:
[0039] Upstream primer (shown as SEQ ID NO:2):
[0040] GACACGCTAGCATGTACAGGATGCAACTCCTGTCTTG
[0041] Downstream primer (shown as SEQ ID NO:3):
[0042] GACACGGATCCTTACTGGGATGCTCTTCGACC
[0043] Under the action of the above-mentioned upstream and downstream primers containing specific restriction sites, pfu polymerase is used to amplify through PCR reaction to obtain the first round of PCR pr...
Embodiment 2
[0067] Example 2 Expression of target protein in liver cancer cells:
[0068] HepG2 human liver cancer cells were digested with 0.05% trypsin working solution for 5 minutes to detach the wall, then gently pipetted, dispersed into a single cell suspension and counted. at 0.5×10 6 The number of cells per well, cultured in DMEM high-glucose medium containing 10% fetal bovine serum at 37°C, 5% CO 2 and a constant temperature incubator with a relative humidity of 95%. When the confluency of the cells reaches 50%, discard the culture medium and gently wash the cells with PBS for 3 times to prepare for transfection.
[0069] Dilute 2 μg of pIRES2-EGFP-IL-2-IFNγ eukaryotic expression system and pIRES2 plasmid vector in 0.1mL Opti- In Medium, place at 20°C for 10 minutes. Meanwhile, dilute 10 μL of Lipofection2000 transfection reagent in 0.1 mL Opti- In Medium, place at 20°C for 10 minutes. The diluted two kinds of plasmid systems and the diluted Lipofection2000 transfection reag...
PUM
Property | Measurement | Unit |
---|---|---|
molecular weight | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap