Small-hairpin RNA recombinant carrier expressed by targeted inhibition integrin beta 1 and construction method thereof

An RNA recombination and integrin technology, applied in the field of genetic engineering, can solve the problems of incompetent targeting of small hairpin RNA recombinant expression vectors, and achieve the effects of good specificity, high transfection efficiency and good safety.

Inactive Publication Date: 2017-07-14
SHENZHEN PEOPLES HOSPITAL
View PDF3 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0006] It has been reported that the β1 subunit of Integrin can mediate the interaction between cells and cells, between cells and ECM, etc., and play an important role in the pathophysiologica

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Small-hairpin RNA recombinant carrier expressed by targeted inhibition integrin beta 1 and construction method thereof
  • Small-hairpin RNA recombinant carrier expressed by targeted inhibition integrin beta 1 and construction method thereof
  • Small-hairpin RNA recombinant carrier expressed by targeted inhibition integrin beta 1 and construction method thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0026] Example 1 Design and synthesis of oligonucleotide chains

[0027] According to the integrin β1 mRNA gene sequence (NM_16412), after the specificity was confirmed by BLAST homology comparison, the possibility of shRNA non-specific inhibition of other gene fragments was excluded, and the small hairpin RNA design software was used to select the integrin β1 mRNA target sequence and screen the integrin The 425th nucleotide in the coding region of β1 mRNA is used as the target site for interference initiation, which consists of BamH I restriction site + target sequence sense strand + stem-loop structure + target sequence antisense strand + EcoR I restriction site Nucleotide chains (SEQ ID NO: 1 and SEQ ID NO: 2).

[0028] At the same time, a negative control (missense RNA strand), an empty vector control (plasmid vector) and a blank control (PBS) were established. The sense strand of the negative control: GATCCCGACTACCGTTGTGTATAGGTGTTCAAGAGACACCTATACAACG GTAGTTTTTTG, namely ...

Embodiment 2

[0029] Example 2 Construction of Small Hairpin RNA Recombinant Vector

[0030]The RNAi-Ready pSIREN-RetroQ-ZsGreen1 vector was digested with BamHI and EcoRI to linearize it, and the oligonucleotide chain targeting the integrin β1 gene synthesized in Example 1 was prepared as an annealed double-stranded DNA, and inserted in the forward direction and digested In the multiple cloning site of the RNAi-Ready pSIREN-RetroQ-ZsGreen1 vector, the ligation product was transformed into DH-5а competent cells, and the bacterial solution was evenly spread on the agar plate containing ampicillin (100 μg / ml), and cultured upside down overnight Afterwards, positive clones were picked, and the bacterial liquid was amplified in the LB culture solution containing ampicillin (100 μg / ml), and part of the bacterial liquid was taken for sequencing. The partial sequence diagram is as follows: figure 2 As shown, the sequencing results showed that the insertion was correct. The plasmid is extracted fr...

Embodiment 3

[0032] Example three ASMC in vitro transfection

[0033] ASMCs in logarithmic growth phase were digested, centrifuged, supernatant removed, resuspended in DMEM culture medium containing 10% fetal bovine serum, and 1×10 5 Cells were seeded in a 6-well culture plate, and when the cell confluence reached 80%, the culture medium was replaced with serum-free DMEM culture medium at 37°C, 5% CO 2 Cultured in the incubator for 24 hours, then transfected cells according to the operation instructions of Lipofectine 2000, divided into the following 5 groups and treated them separately: ①Blank control group: only PBS was added; ②Empty vector control group: transfected with empty plasmid vector; ③Negative Control group: transfected with the recombinant vector of missense RNA chain; ④ Intervention treatment group: transfected with the small hairpin RNA recombinant vector of the present invention.

[0034] The specific process of cell transfection is as follows: Prepare cell transfection so...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention discloses a small-hairpin RNA recombinant carrier expressed by targeted inhibition integrin beta 1, which includes a basic sequence, a resistant gene sequence, a polyclonal locus sequence, a promoter sequence of an RNAi-Ready pSIREN-RetroQ-ZsGreen1 carrier, and an oligonucleotide chain of a targeted integrin beta 1 gene. The polyclonal locus includes a BamH I enzyme digestion locus and an EcoR I enzyme digestion locus. The oligonucleotide chain is composed of the BamH I enzyme digestion locus, a target sequence positive-sense strand, a stem-loop structure, a target sequence antisense strand, and the EcoR I enzyme digestion locus. The oligonucleotide chain is inserted into the polyclonal locus in the forward direction. The invention belongs to the technical field of gene engineering. The small-hairpin RNA recombinant carrier can targetedly inhibit expression of the integrin beta 1, has high specificity, high-effective and stable expression and high transfection efficiency.

Description

technical field [0001] The invention belongs to the technical field of genetic engineering, and in particular relates to a small hairpin RNA recombination vector targeting to inhibit the expression of integrin β1 and a construction method thereof. Background technique [0002] Asthma is a common and frequently-occurring disease of the respiratory system. Its disability and mortality rates have been on the rise, and it has become a serious social health problem. The pathogenesis of asthma is not fully understood, but airway inflammation and airway remodeling are the two main features of asthma. Airway remodeling can lead to irreversible airway spasm, which is the main reason why some asthmatics have difficulty controlling symptoms with asthma drugs. [0003] A large number of existing studies have confirmed that airway smooth muscle cells (airway smooth muscle cells, ASMC) are the main effector cells that cause airway narrowing, and are an important class of immune regulator...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
IPC IPC(8): C12N15/85C12N15/66
CPCC12N15/66C12N15/85C12N2810/10
Inventor 邱晨李杰王凌伟何旗
Owner SHENZHEN PEOPLES HOSPITAL
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap