Unlock instant, AI-driven research and patent intelligence for your innovation.

A modified lignocellulosic enzyme and its application

A lignocellulase and lignin technology, applied in the field of genetic engineering, can solve the problems of reducing cellulase activity and reducing the binding activity of cellulase and cellulose

Active Publication Date: 2020-12-01
SHANDONG HENGLU BIOTECH CO LTD
View PDF3 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

At the same time, the hydrogen bonding produced by polar amino acids also plays a role in the binding (Hilden and Johansson, 2004), and mutations of these polar amino acid sites may affect the formation of hydrophobic surfaces and reduce the binding of cellulase to cellulose activity, thereby reducing cellulase activity

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A modified lignocellulosic enzyme and its application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0034] Embodiment 1 describes the strains and carriers used in the following examples. Embodiments 2 to 6 describe in detail the modified Trichoderma reesei Cel7A mutant and its purification process in the present invention. Embodiments 7 and 8 The expression and purification of the β-glucosidase used in the implementation process are described in detail. Example 9 describes the preparation process of acid-insoluble lignin, and Example 10 describes the hydrolysis activity of the modified Cel7A mutant of the present invention. improve.

[0035] Cloning of embodiment 1 Trichoderma reesei cellobiohydrolase I (Cel7A) coding gene in vector pUG6

[0036] The Cel7A coding gene and its upstream and downstream fragments were cloned in Trichoderma reesei QM6a by PCR; the primer sequences are as follows:

[0037] F1: GCAAATGGTACGTACGGACAGTTCAGGCCGCGGATCTGCCGGTCTCCCTA

[0038] R1: TGCGGTTGTGCGACCTTTCAGCTCTGGCGTTCTATAGTGTCACCTAAATCG

[0039] The PCR reaction was carried out in a 50μl sy...

Embodiment 2

[0057] Example 2: Point mutations in the carbohydrate binding region

[0058] Use the point mutation kit KOD-plus-mutagensis kit (purchased from Toyobo Co., Ltd., Japan) to carry out point mutations on the carbohydrate-binding region of Cel7A in the constructed plasmid pTCI. The mutation method is strictly in accordance with the instructions of the kit. The mutated plasmid Amplification was performed in E. coli Trans 5α. The sequences of point mutation primers are as follows:

[0059] S14D-F:GTATTGGCTACGATGGCCCCACGG

[0060] S14D-R:CGCCGCACTGGCCGTAGTGAGACT

[0061] S21D-F: GGTCTGCGCCGATGGCACAACTTG

[0062] S21D-R:GTGGGGCCGCTGTAGCCAATACCG

[0063] T24D-F:CCAGCGGCACAGATTGCCAGGTCCT

[0064] T24D-R:CGCAGACCGTGGGGCCGCTGTAGC

[0065] A total of five plasmids containing mutations at different sites in the carbohydrate binding region were obtained through this step: S14D, S21D, T24D or S14D / S21D or S14D / S21D / T24D.

[0066] After sequencing, the serine at the 14th position was r...

Embodiment 3

[0071] Embodiment 3: Transformation of the carbohydrate binding region in Trichoderma reesei Cel7A

[0072] After constructing the mutated plasmid in the carbohydrate binding region obtained in Example 2 and verifying correctness by sequencing, a large number of clones were amplified in Escherichia coli Trans 5α, and the obtained plasmid was transformed into Trichoderma reesei QM6a by homologous recombination. Protoplasts were constructed to obtain a Cel7A expression strain containing mutations in the target site of the carbohydrate binding region. Protoplast preparation and transformation methods refer to filamentous fungal transformation methods (Liu et al., 2016, Regulation of cellulase expression, sporulation, and morphogenesis by velvet family proteins in Trichoderma reesei. Applied Microbiology and Biotechnology 100(2):769-779.). The constructed transformant was verified with primer pair F4 / R4, the size of the fragment amplified in the wild-type genome was 2121bp, and th...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to modified lignocellulolytic enzyme and application thereof. The following modification is carried out in a carbohydrate binding area: fourteenth-site serine in the carbohydrate binding area is replaced with aspartic acid; or, twenty-first-site serine in the carbohydrate binding area is replaced with the aspartic acid; or, twenty-fourth-site threonine in the carbohydrate binding area is replaced with the aspartic acid; or, the fourteenth-site serine and the twenty-first-site serine in the carbohydrate binding area are replaced with the aspartic acid at the same time; or, the fourteenth-site serine, the twenty-first-site serine and the twenty-fourth-site threonine in the carbohydrate binding area are replaced with the aspartic acid at the same time. According to the modified carbohydrate binding area of the modified lignocellulolytic enzyme, in comparison with parent cellulase containing a parent carbohydrate binding area, the hydrolytic activity is improved; the parent carbohydrate binding area is connected with the same cellulase catalytic structural domain existing in cellulase in an operable manner through a connecting area.

Description

technical field [0001] The present invention relates to a modified lignocellulase and its application, in particular to a gene construct comprising a nucleic acid sequence encoding the modified cellulase, a method for producing the modified cellulase from a host strain and using the modified cellulase The invention relates to a method for hydrolyzing cellulose by modified cellulase in the presence of lignin, which belongs to the technical field of genetic engineering. Background technique [0002] Cellulose is the most important light and reaction product on land. Because of its large storage capacity, short production cycle, green and non-polluting characteristics, degrading cellulose to obtain biofuels to replace increasingly depleted fossil raw materials is favored by people. The degradation of lignocellulose is divided into acid degradation and cellulase degradation: since World War II, the acid degradation method has been proved to have low sugar yield, high cost, and l...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N9/42C12P19/14C12P19/02
CPCC12N9/2437C12P19/02C12P19/14C12Y302/01004
Inventor 方诩
Owner SHANDONG HENGLU BIOTECH CO LTD