A modified lignocellulosic enzyme and its application
A lignocellulase and lignin technology, applied in the field of genetic engineering, can solve the problems of reducing cellulase activity and reducing the binding activity of cellulase and cellulose
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0034] Embodiment 1 describes the strains and carriers used in the following examples. Embodiments 2 to 6 describe in detail the modified Trichoderma reesei Cel7A mutant and its purification process in the present invention. Embodiments 7 and 8 The expression and purification of the β-glucosidase used in the implementation process are described in detail. Example 9 describes the preparation process of acid-insoluble lignin, and Example 10 describes the hydrolysis activity of the modified Cel7A mutant of the present invention. improve.
[0035] Cloning of embodiment 1 Trichoderma reesei cellobiohydrolase I (Cel7A) coding gene in vector pUG6
[0036] The Cel7A coding gene and its upstream and downstream fragments were cloned in Trichoderma reesei QM6a by PCR; the primer sequences are as follows:
[0037] F1: GCAAATGGTACGTACGGACAGTTCAGGCCGCGGATCTGCCGGTCTCCCTA
[0038] R1: TGCGGTTGTGCGACCTTTCAGCTCTGGCGTTCTATAGTGTCACCTAAATCG
[0039] The PCR reaction was carried out in a 50μl sy...
Embodiment 2
[0057] Example 2: Point mutations in the carbohydrate binding region
[0058] Use the point mutation kit KOD-plus-mutagensis kit (purchased from Toyobo Co., Ltd., Japan) to carry out point mutations on the carbohydrate-binding region of Cel7A in the constructed plasmid pTCI. The mutation method is strictly in accordance with the instructions of the kit. The mutated plasmid Amplification was performed in E. coli Trans 5α. The sequences of point mutation primers are as follows:
[0059] S14D-F:GTATTGGCTACGATGGCCCCACGG
[0060] S14D-R:CGCCGCACTGGCCGTAGTGAGACT
[0061] S21D-F: GGTCTGCGCCGATGGCACAACTTG
[0062] S21D-R:GTGGGGCCGCTGTAGCCAATACCG
[0063] T24D-F:CCAGCGGCACAGATTGCCAGGTCCT
[0064] T24D-R:CGCAGACCGTGGGGCCGCTGTAGC
[0065] A total of five plasmids containing mutations at different sites in the carbohydrate binding region were obtained through this step: S14D, S21D, T24D or S14D / S21D or S14D / S21D / T24D.
[0066] After sequencing, the serine at the 14th position was r...
Embodiment 3
[0071] Embodiment 3: Transformation of the carbohydrate binding region in Trichoderma reesei Cel7A
[0072] After constructing the mutated plasmid in the carbohydrate binding region obtained in Example 2 and verifying correctness by sequencing, a large number of clones were amplified in Escherichia coli Trans 5α, and the obtained plasmid was transformed into Trichoderma reesei QM6a by homologous recombination. Protoplasts were constructed to obtain a Cel7A expression strain containing mutations in the target site of the carbohydrate binding region. Protoplast preparation and transformation methods refer to filamentous fungal transformation methods (Liu et al., 2016, Regulation of cellulase expression, sporulation, and morphogenesis by velvet family proteins in Trichoderma reesei. Applied Microbiology and Biotechnology 100(2):769-779.). The constructed transformant was verified with primer pair F4 / R4, the size of the fragment amplified in the wild-type genome was 2121bp, and th...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 
