Aspergillus oryzae lipase mutant and application thereof

A technology of Aspergillus oryzae lipase and mutant, which is applied in the fields of enzyme engineering and genetic engineering, can solve the problems of low yield of Aspergillus oryzae lipase, unsatisfactory catalytic activity, and unsatisfactory stability, and achieves improved hydrolysis activity and good thermal stability. Effect

Active Publication Date: 2019-06-25
ZHEJIANG UNIV OF TECH
View PDF2 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The yield of wild Aspergillus oryzae lipase is low, and the catalytic activity and stability are not ideal, so it is necessary to use molecular transformation technology to improve

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Aspergillus oryzae lipase mutant and application thereof
  • Aspergillus oryzae lipase mutant and application thereof
  • Aspergillus oryzae lipase mutant and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0022] Embodiment 1: Construction of Aspergillus oryzae lipase mutant library by random mutation

[0023] Utilize the error-prone PCR kit (the kit is purchased from Beijing Tianenze Gene Technology Co., Ltd.) in vitro to Aspergillus oryzae lipase gene aol-3 (nucleotide sequence is shown in SEQ ID NO.2, amino acid sequence is SEQ ID shown in NO.1) to introduce nucleotide mutations.

[0024] Error-prone PCR reaction conditions and primers (30μL system):

[0025]Aspergillus oryzae lipase gene (SEQ ID NO.2) DNA template with a concentration of 1 ng / μL, 1 μL of primers 1F and 1R at a concentration of 10 μM, 3 μL of 10× error-prone PCR Mix, 3 μL of 10× dNTP for error-prone PCR, easy MnCl for wrong PCR 2 4 μL, 2 μL of dGTP for error-prone PCR, 0.5 μL of 5 U / μL Taq DNA polymerase for error-prone PCR, and 14.5 μL of ultrapure water.

[0026] Primer 1F: 5' TAAGAAGGAGATATA CCATGGCACATCTGGCCATTAAGAGCC 3'

[0027] Primer 1R: 5' GTGGTGGTGGTGGTG CTCGAGGTTGGCGGCTGCAACTG 3'

[0028] ...

Embodiment 2

[0031] Example 2: Mutant library screening

[0032] The transformant that embodiment 1 obtains is carried out as follows:

[0033] 1. Selection of mutants: Transfer the mutants obtained above to a new LB solid medium containing 100 μg / mL kanamycin, label each mutant, and culture at 37°C overnight.

[0034] 2. Plate screening of mutants: Add IPTG with a final concentration of 0.1 mM to the screening medium containing 100 μg / mL kanamycin, spot the labeled mutants on the screening plate, and ensure that the numbers correspond to each other. Cultivate in a 37°C incubator for 24h-48h. During this period, observe whether there is a hydrolysis circle and the size of the hydrolysis circle.

[0035] 3. Re-screening of mutants: Transfer the mutants with larger hydrolysis circle obtained from the primary screening to LB liquid medium, culture at 37°C for 10 hours, and transfer the culture solution to LB culture with an inoculum volume concentration of 1%. cultured at 37°C until OD 60...

Embodiment 3

[0044] Example 3: Verification and purification of high-yield Aspergillus oryzae lipase production strain

[0045] The mutant bacteria AOL-3 in embodiment 2 were respectively F38N and mutant AOL-3 F38N-V230R Inoculate in LB liquid medium, cultivate at 37°C for 10 hours, inoculate the culture solution into LB medium with an inoculum volume concentration of 1%, and cultivate at 37°C until the cells grow to OD 600 When the concentration was 0.6, add IPTG with a final concentration of 0.1mM to induce, continue to culture at 28°C for 12h, collect the bacterial cells by centrifugation, resuspend with pH 7.5 phosphate buffer, and ultrasonically disrupt the cells for 10min with a sonicator (power 100W, Break for 2s, stop for 6s), the supernatant is the mutant strain AOL-3 F38N and AOL-3 F38N-V230R enzyme solution. According to the instructions of GE's 25mL nickel ion affinity chromatography filler and AKAT purification instrument, the supernatant was loaded onto a pre-equilibrated...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
optical purityaaaaaaaaaa
Login to View More

Abstract

The invention discloses an aspergillus oryzae lipase mutant and application thereof in disassembling (R,S)-2-(4-hydroxyphenoxy)propionate for preparing (R)-2-(4-hydroxyphenoxy)propionate. The mutant is obtained by site-saturated single or multiple mutations of the 38th site or the 230th site of the amino acid sequence in SEQ ID NO.1. By comparing the hydrolysis capability of mutant enzymes AOL-3F38N and AOL-3F38N-V230R and the non-mutated enzyme AOL-3, a user finds that the hydrolytic activity of the mutant enzymes AOL-3F38N and AOL-3F38N-V230R is 3.4 times and 4.0 times that of the non-mutated lipase, the thermal stability of the modified lipase is better after 50 DEG C, and the yield of the (R)-2-(4-hydroxyphenoxy)propionate is increased. The mutant is more suitable for industrial production.

Description

(1) Technical field [0001] The invention relates to an Aspergillus oryzae lipase mutant obtained by random mutation combined with site-directed saturation mutation and the application of splitting (R,S)-2-(4-hydroxyphenoxy)ethyl propionate, which belongs to enzyme engineering, field of genetic engineering technology. (2) Background technology [0002] Lipase (EC 3.1.1.3, triacylglycerol lipase) is a triglyceride hydrolase, which can act on the oil-water interface and perform various reactions such as esterification, ester hydrolysis, alcoholysis, and transesterification. Lipase widely exists in nature and has various sources, and is found in plants, animals, and microorganisms. Among them, the acquisition of lipase-producing microorganisms is relatively simple, suitable for large-scale production, and has the advantages of short fermentation cycle. It is an important source and research focus of industrial lipase. The lipase-producing microorganisms are mainly concentrated...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N9/20C12P41/00C12P7/62
Inventor郑建永钟伟超蓝星章银军汪钊
OwnerZHEJIANG UNIV OF TECH