Unlock instant, AI-driven research and patent intelligence for your innovation.

Precocious trifoliate orange PtAGL24 gene separation and application with effect of regulating and controlling plant early blossoming

A technology of AGL24 and ptagl24, which is applied in the field of separation and application of PtAGL24 gene of Aurantium japonica to achieve the effects of shortening flowering time and shortening childhood

Inactive Publication Date: 2017-10-10
HUAZHONG AGRI UNIV
View PDF1 Cites 6 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] At present, the homologous genes of AGL24 / SVP have been isolated in various species, and there are certain differences in function

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Precocious trifoliate orange PtAGL24 gene separation and application with effect of regulating and controlling plant early blossoming
  • Precocious trifoliate orange PtAGL24 gene separation and application with effect of regulating and controlling plant early blossoming
  • Precocious trifoliate orange PtAGL24 gene separation and application with effect of regulating and controlling plant early blossoming

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0038] Example 1 Isolation and sequence analysis of PtAGL24 gene

[0039] In order to obtain the homologous gene of AGL24 in citrus, this embodiment utilizes the CDS sequence of Arabidopsis AGL24 gene (Gene ID is AT4G24540) in the sweet orange database (https: / / phytozome.jgi.doe.gov / pz / portal. html#!info?alias=Org_Csinensis) to perform a Blast search, and the sequence with the highest homology obtained is the nucleotide sequence of the AGL24 gene (Gene ID is orange1.1g027190m) in citrus, and the Primer 5.0 software is used to design primers according to the general In principle, primers were designed in the 5'-UTR region and 3'-UTR region of the gene to amplify the full-length cDNA sequence.

[0040] RNA was extracted and reverse-transcribed from Trifoliate trifoliate Fructus (taken from the herbarium of Huazhong Agricultural University, literature source: Liang Suiquan et al., 1999; Zhang et al.2011), and the obtained first-strand cDNA was used to amplify the PtAGL24 gene. f...

Embodiment 2

[0042] Example 2 Cloning and bioinformatics analysis of PtAGL24 promoter

[0043] Referring to the sweet orange genome, find out the upstream promoter sequence of the PtAGL24 gene, use the software Primer5.0 to design primers according to the general principles of primer design, and use the CTAB method to extract the genomic DNA of the leaves of Trifoliate trifoliate Fructus. The DNA extraction method refers to the method reported by Cheng Yunjiang (Cheng et al. 2003). Using this DNA as a template, high-fidelity Taq enzyme was used to amplify the promoter. The sequence of the primer pair used to amplify the PtAGL24 promoter is as follows:

[0044] Forward primer: 5'‐GATAAGATAAATCGGAAAT‐3'

[0045] Reverse primer: 5'‐AATAATATATAATAAGCAGA‐3'

[0046] The amplified promoter fragment was detected by electrophoresis on 1% agarose gel, and the target fragment was recovered and purified according to the operation manual of the agarose gel recovery kit (purchased from Shanghai Jieru...

Embodiment 3

[0050] Example 3 Subcellular localization of PtAGL24 protein

[0051](1) Vector preparation: It was predicted that PtAGL24 protein might be localized in the nucleus by using the PSORT program. In order to verify this prediction result, a vector fused with the coding sequence of PtAGL24 and GFP protein was constructed. According to the multiple cloning site and the PtAGL24 sequence of the pCAMBIA1302 vector (purchased from the CAMBIA laboratory in Australia), use Primer Premier 5.0 software to design the primers for amplifying PtAGL24 according to the principle of general design primers. The Nco I restriction site was added to the 'end respectively (see Table 3). The primer sequences are:

[0052] Forward primer: 5'‐ccatggGGCTTTAGGTTACTGTGATC‐3';

[0053] Reverse primer: 5'‐ccatggGCTGGAGTAGGGAAGCCCTA‐3' (Note: lowercase letters are the added restriction sites).

[0054] PtAGL24 was amplified using the bacterial solution of PtAGL24 and pMD18-T (purchased from Treasure Bioengi...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the technical field of plant genetic engineering. Specifically, it relates to the separation and application of the PtAGL24 gene that can regulate the early flowering of plants. The nucleotide sequence of the PtAGL24 gene is shown in SEQ ID NO: 1, the sequence of the protein encoded by the gene is shown in SEQ ID NO: 2; the nucleotide sequence of the promoter PtAGL24P is shown in SEQ ID NO: 3. The ectopic overexpression of the gene can significantly shorten the childhood period of the plant and promote the early flowering of the plant. The gene and promoter of the invention provide biological resources for the breeding of perennial woody fruit trees and the shortening of flowering process. The role of PtAGL24 in the whole development process of the plant is further revealed through the spatial expression of the promoter, which shows that the cloned gene of the present invention is also induced by the low temperature of the environment, and has a certain response to the external environmental stress. The gene and promoter of the present invention can be used in regulating plant flowering period and low temperature stress.

Description

technical field [0001] The invention belongs to the technical field of plant genetic engineering. Specifically, it relates to the separation and application of the PtAGL24 gene that can regulate the early flowering of plants. Background technique [0002] Flowering and fruiting is an important biological process in the life cycle of flowering plants, the central link in the plant's own development process, and the basis for fruit tree production and fruit industry product processing. Citrus is an evergreen fruit tree widely cultivated in tropical and subtropical regions, and it is also the number one fruit in the world. Its yield and economic benefits determine its position in the entire fruit tree production. Due to the relatively long childhood of citrus, coupled with the problems of nucellus embryo intervention, partial reproductive organ abortion, and extreme heterozygosity in traditional citrus breeding, it is difficult to cross-breed citrus. In the extension, the bre...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/29C12N15/113C07K14/415A01H5/00
CPCC07K14/415C12N15/827C12N15/8273
Inventor 胡春根张金智侯小进孙雷鸣
Owner HUAZHONG AGRI UNIV
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More