Bombyx mori microsporidia dna2 gene and its application
A technology of microsporidia and silkworm, applied in the direction of recombinant DNA technology, DNA / RNA fragments, applications, etc., can solve the problem of interference with pathogenic gene DNA, etc., achieve good specificity and sensitivity, and good application prospects
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0032] Example 1 DNA2 gene cloning
[0033] 1. Primer design
[0034] Homology analysis and prediction: By means of homology analysis with other species of Microsporidia genome genes, ORF-F / ORF-R amplification primers for the coding region of the DNA2 gene sequence of Bombyx mori were designed:
[0035] Primer ORF-F (shown in SEQ ID NO.4):
[0036] 5'ATTATCATATGAACAACAATAAGTC 3';
[0037] Primer ORF-R (shown in SEQ ID NO.5):
[0038] 5' ATATGAAGCTTCATAAAATCTCTAAT 3'.
[0039] 2. PCR amplification and cloning
[0040] Using the genome DNA of Bombyx mori Microsporidia as a template, the target gene was amplified by PCR with primers ORF-F / ORF-R, the cloned fragment was connected to the PET28A carrier, and then sent to the company (Shanghai Shenggong) for sequencing. After verification and analysis of the results, the full-length sequence of the DNA2 gene of N. silkworm was obtained as shown in SEQ ID NO.1, and the sequence of the coding region was shown as SEQ ID NO.2.
[0...
Embodiment 2
[0044] Embodiment 2 Utilizes DNA2 gene to detect microsporidia
[0045] 1, designed the detection primer set as shown in table 1 (such as image 3 shown):
[0046] Table 1 PCR primers for DNA2 gene verification and detection of the transcriptome of N. silkworm (Guangdong strain)
[0047]
[0048]
[0049] 2. Detection specificity
[0050] With several different microsporidia DNA templates, the above primers were used for PCR detection. The results showed that the primer groups in Table 1 all had detection specificity for Bombyx mori microsporidia. Such as Figure 4 and Figure 5 shown.
[0051] 3. Detection sensitivity
[0052] Sensitivity test results show that the sensitivity of the detection primer F / R is the best (such as Figure 6 shown), the N. silkworm DNA2 gene was used as a specific primer for detecting N. silkworm in the mulberry environment, and the concentration of 10 -4 ng / ul DNA.
[0053] Moreover, the amplified fragment of the detection primer F / R...
Embodiment 3
[0055] Example 3 DNA2 gene expression level
[0056] 1. Detect the expression level of N.b DNA2 gene in the silkworm midgut and silkworm eggs infected with Microsporidium silkworm, the results are as follows: Figure 7 and Figure 8 shown.
[0057] Figure 7 : The relative expression of N.b DNA2 gene in each time period in the midgut of susceptible silkworm is as follows:
[0058] 6h: 1.55; 12h: 16.67; 24h: 118.96; 48h: 194.99:; 72h: 17.17; 96h: 5.49; 120h: 25.89; 144h: 4.33; Group expression level: 1.
[0059] Figure 8 : The relative expression levels of N.b DNA2 gene in each time period in the susceptible silkworm eggs are as follows:
[0060] 1h: 1.06; 12h: 7.48; 24h: 55.83; 48: 13.66; 72h: 5.91; 96h: 3.39; 120h: 2.01; 144h: 1.52; 168h: 1.30; 192h: 1.23;
[0061] The results showed that after No. silkworm infects silkworms, No. silkworm can be detected from the midgut and silkworm eggs in time at an early stage, combined with real-time fluorescent quantitative PCR d...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap