Check patentability & draft patents in minutes with Patsnap Eureka AI!

Bombyx mori microsporidia dna2 gene and its application

A technology of microsporidia and silkworm, applied in the direction of recombinant DNA technology, DNA / RNA fragments, applications, etc., can solve the problem of interference with pathogenic gene DNA, etc., achieve good specificity and sensitivity, and good application prospects

Active Publication Date: 2019-10-22
SOUTH CHINA AGRI UNIV
View PDF4 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The commonly used target gene SSUrRNA in the prior art, the study found that the primers designed based on the conserved segment of 16SrDNA detect silkworm egg microsporidia, often there will be non-target bands, it is speculated that there may be some inhibitory substances in the silkworm egg extract Interfering with the effective PCR amplification of pathogenic gene DNA

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Bombyx mori microsporidia dna2 gene and its application
  • Bombyx mori microsporidia dna2 gene and its application
  • Bombyx mori microsporidia dna2 gene and its application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0032] Example 1 DNA2 gene cloning

[0033] 1. Primer design

[0034] Homology analysis and prediction: By means of homology analysis with other species of Microsporidia genome genes, ORF-F / ORF-R amplification primers for the coding region of the DNA2 gene sequence of Bombyx mori were designed:

[0035] Primer ORF-F (shown in SEQ ID NO.4):

[0036] 5'ATTATCATATGAACAACAATAAGTC 3';

[0037] Primer ORF-R (shown in SEQ ID NO.5):

[0038] 5' ATATGAAGCTTCATAAAATCTCTAAT 3'.

[0039] 2. PCR amplification and cloning

[0040] Using the genome DNA of Bombyx mori Microsporidia as a template, the target gene was amplified by PCR with primers ORF-F / ORF-R, the cloned fragment was connected to the PET28A carrier, and then sent to the company (Shanghai Shenggong) for sequencing. After verification and analysis of the results, the full-length sequence of the DNA2 gene of N. silkworm was obtained as shown in SEQ ID NO.1, and the sequence of the coding region was shown as SEQ ID NO.2.

[0...

Embodiment 2

[0044] Embodiment 2 Utilizes DNA2 gene to detect microsporidia

[0045] 1, designed the detection primer set as shown in table 1 (such as image 3 shown):

[0046] Table 1 PCR primers for DNA2 gene verification and detection of the transcriptome of N. silkworm (Guangdong strain)

[0047]

[0048]

[0049] 2. Detection specificity

[0050] With several different microsporidia DNA templates, the above primers were used for PCR detection. The results showed that the primer groups in Table 1 all had detection specificity for Bombyx mori microsporidia. Such as Figure 4 and Figure 5 shown.

[0051] 3. Detection sensitivity

[0052] Sensitivity test results show that the sensitivity of the detection primer F / R is the best (such as Figure 6 shown), the N. silkworm DNA2 gene was used as a specific primer for detecting N. silkworm in the mulberry environment, and the concentration of 10 -4 ng / ul DNA.

[0053] Moreover, the amplified fragment of the detection primer F / R...

Embodiment 3

[0055] Example 3 DNA2 gene expression level

[0056] 1. Detect the expression level of N.b DNA2 gene in the silkworm midgut and silkworm eggs infected with Microsporidium silkworm, the results are as follows: Figure 7 and Figure 8 shown.

[0057] Figure 7 : The relative expression of N.b DNA2 gene in each time period in the midgut of susceptible silkworm is as follows:

[0058] 6h: 1.55; 12h: 16.67; 24h: 118.96; 48h: 194.99:; 72h: 17.17; 96h: 5.49; 120h: 25.89; 144h: 4.33; Group expression level: 1.

[0059] Figure 8 : The relative expression levels of N.b DNA2 gene in each time period in the susceptible silkworm eggs are as follows:

[0060] 1h: 1.06; 12h: 7.48; 24h: 55.83; 48: 13.66; 72h: 5.91; 96h: 3.39; 120h: 2.01; 144h: 1.52; 168h: 1.30; 192h: 1.23;

[0061] The results showed that after No. silkworm infects silkworms, No. silkworm can be detected from the midgut and silkworm eggs in time at an early stage, combined with real-time fluorescent quantitative PCR d...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The present invention discloses a nosema bombycis DNA2 gene and application thereof. According to the invention, firstly cloning is carried out to acquire the nosema bombycis DNA2 gene with a full-length sequence shown as SEQ ID NO.1, an ORF rame sequence is shown as SEQ ID NO.2, and an amino acid sequence of encoding protein is shown as SEQ ID NO.3. On the basis, the invention also provides a specific detection primer set for specific detection of nosema bombycis, the specific detection primer set has very good specificity and sensitivity on nosema bombycis, and has very good application prospect in specific detection of nosema bombycis. Moreover, as a newly discovered protein gene, the nosema bombycis DNA2 gene has potential functional application. Discovery of the DNA2 gene provided by the invention has certain significance for theoretical verification and production practice of treatment and detection.

Description

technical field [0001] The invention belongs to the field of biotechnology. More specifically, it relates to a helicase and nuclease DNA2 gene (DNA replication ATP-dependent helicase / nuclease DNA2-like) derived from Microsporidium silkworm and its application. Background technique [0002] Bombyx mori microsporidiosis is a devastating disease caused by pathogenic silkworm Nosema bombycis (N.b) infected by food or embryo (fetus). Microsporidia silkworm is a kind of obligate intracellular parasitic eukaryotic organisms, which belonged to protozoa before, but were classified as fungi in recent years. Because of its vertical transmission characteristics, it has become the most concerned one among the pathogenic microorganisms of silkworm, and therefore it has become the only epidemic disease among the pathogenic microorganisms of silkworm that needs to be quarantined. From the discovery in the 19th century to the present, the silkworm microsporidiosis has caused huge losses to...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N15/55C12N9/22C12N9/14C12Q1/6895C12Q1/04C12N15/11C12R1/645
Inventor 刘吉平李峙贤孙勋勋杨宏宇
Owner SOUTH CHINA AGRI UNIV
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More