Unlock instant, AI-driven research and patent intelligence for your innovation.

Recombinant staphylococcus aureus B enterotoxin protein and application thereof

A staphylococcus, golden yellow technology, applied in the field of genetic engineering, can solve the problems of low production of natural toxins, limitations in research and application, and achieve the effects of saving protein production time, fast inducing expression, and high yield

Pending Publication Date: 2017-11-03
曾庆明
View PDF1 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the yield of natural toxins is low, and its research and application are limited

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Recombinant staphylococcus aureus B enterotoxin protein and application thereof
  • Recombinant staphylococcus aureus B enterotoxin protein and application thereof
  • Recombinant staphylococcus aureus B enterotoxin protein and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0070] The construction of embodiment 1 recombinant plasmid pET32a-SEB

[0071] (1) Amplify the gene encoding recombinant Staphylococcus aureus type B enterotoxin protein

[0072] According to the published Staphylococcus aureus type B enterotoxin protein sequence (NCBI Reference Sequence: WP_072497559.1), re-optimize the design of the Staphylococcus aureus type B enterotoxin protein sequence, design and synthesize 34 primers according to the optimized gene sequence, A sufficient amount of target product DNA was amplified by the first round of PCR, wherein the reaction system (50 μL) was as follows:

[0073]

[0074] Among them, the primer mix is ​​primer X5523-1~X5523-34, 34 in total, 0.4μL×34=13.6μL; the primer sequence is as follows:

[0075] X5523-1: GACACGGTACCGAGAACCTGTACTTCCAG;

[0076] X5523-2: CGGGTCCGGCTGGCTTTCGCCCTGGAAGTACAGGTTCTCG;

[0077] X5523-3: GCCAGCCGGACCCGAAACCGGATGAACTGCACAAAAGCAG;

[0078] X5523-4: TCCATCAGGCCGGTGAATTTGCTGCTTTTGTGCAGTTCAT;

[0079...

Embodiment 2

[0122] Example 2 Construction of a strain expressing recombinant Staphylococcus aureus type B enterotoxin protein

[0123] Take 1 μL of the recombinant plasmid pET32a-SEB prepared in step (5) of Example 1 to transform BL21(DE3), heat shock at 42°C for 90 s, and let stand on ice for 2 min; then smear the LB solid plate containing ampicillin at a final concentration of 50 μg / mL Above, after culturing overnight at 37°C, single clones were picked to extract plasmids and sequenced to verify that a strain expressing recombinant Staphylococcus aureus type B enterotoxin protein was obtained.

Embodiment 3

[0124] Example 3 Preparation and Purification of Recombinant Staphylococcus aureus Type B Enterotoxin Protein

[0125] 1. Select the best induction conditions for small test culture

[0126] (1) Pick a single colony of the bacterial strain expressing the recombinant Staphylococcus aureus type B enterotoxin protein in Example 2, add 3 mL of LB liquid medium containing ampicillin at a final concentration of 50 μg / mL to a test tube, and culture overnight at 37° C. ;

[0127] (2) Inoculate the overnight cultured bacterial solution in 4 mL of LB liquid medium containing ampicillin at a final concentration of 50 μg / mL at a volume ratio of 1:100, and culture at 37° C. at 220 rpm;

[0128] (3) When the OD value reaches 0.6, add IPTG with a final concentration of 0.5mM, 220rpm, and perform the following treatment: induce overnight at 20°C or induce for 4h at 37°C, and no IPTG inducer is used as a negative control.

[0129] (4) Centrifuge at 4000rpm for 10min to collect the bacteria, ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the technical field of genetic engineering, and particularly relates to a recombinant staphylococcus aureus B enterotoxin protein and application thereof. Amino acid sequences of the recombinant staphylococcus aureus B enterotoxin protein are shown as SEQ ID NO.1, and nucleotide sequences of genes for encoding the recombinant staphylococcus aureus B enterotoxin protein are shown as SEQ ID NO.2. The nucleotide sequences of the genes for optimized staphylococcus aureus B enterotoxin proteins are recombined in Escherichia coli expression systems, and the recombinant staphylococcus aureus B enterotoxin fusion protein obtained by means of induction expression and purification is high in expression level and yield. Compared with the prior art, the recombinant staphylococcus aureus B enterotoxin protein and the application have the advantages that low-temperature ultrasonic conditions are controlled, two-times nickel agarose affinity chromatography is selected, Triton X-114 reagents are added, accordingly, endotoxins can be removed under the strict control, and the follow-up protein application safety can be guaranteed.

Description

technical field [0001] The invention belongs to the technical field of genetic engineering, and in particular relates to a recombinant Staphylococcus aureus type B enterotoxin protein and its application. Background technique [0002] Staphylococcus aureus (S.aureus) in the Staphylococcus genus is the most pathogenic and often causes food poisoning. Staphylococcus aureus is a Gram-positive coccus with a diameter of 0.8-1.0 μm and a grape shape. No buds, no flagella. Aerobic and facultative anaerobic bacteria, the growth temperature is between 6.5-46°C, and the optimum temperature is 30-37°C. It can grow in the range of pH 4.0-9.8, and the optimum growth pH is 7.4. Can grow in 15% NaCl and 40% bile. Smooth, low-convex, shining, and neat-edged colonies can be formed on ordinary broth solid medium. The colony pigment is unstable, but most of them are golden yellow. [0003] The bacteria can produce enterotoxins that cause food poisoning at 20-37°C. Among them, Staphylococ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C07K14/31C07K1/22C12N15/31C12N15/70C12N1/21C12R1/19
Inventor 曾庆明
Owner 曾庆明
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More