Method for regulating and controlling expression level of saccharomyces cerevisiae genes by using terminators

A Saccharomyces cerevisiae, gene expression technology, applied in the field of bioengineering, can solve the problems of limited production concentration of target products, limited regulatory elements, imbalanced metabolic flow, etc., to achieve efficient and balanced expression, flexible use, high-efficiency fine-tuning means Effect

Inactive Publication Date: 2017-11-07
SHIHEZI UNIVERSITY
View PDF1 Cites 9 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, due to the multi-level influence of exogenous genes in yeast cells such as transcriptional regulation, post-translational modification, and metabolic network coordination, the expression effect of exogenous genes or pathways in yeast cells is limited, resulting in imbalanced metabolic flow and other problems. Finally, the production concentration of the target product is limited, and the fine expression regulation of exogenous genes and metabolic pathways is particularly important
[0003] As the core of metabolic engineering and synthetic biology, metabolic pathway regulation can be regulated to varying degrees at the transcription level, translation level, and protein level, but the regulatory elements that can be applied to Saccharomyces cerevisiae are very limited. Currently, the most commonly used elements are promoters and transcription Both factors are controlled from the "input" of gene expression, and are rarely explored from the perspective of "output"

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for regulating and controlling expression level of saccharomyces cerevisiae genes by using terminators
  • Method for regulating and controlling expression level of saccharomyces cerevisiae genes by using terminators
  • Method for regulating and controlling expression level of saccharomyces cerevisiae genes by using terminators

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0016] Embodiment 1: Construction of terminator verification vector

[0017] Step 1: Obtain the Saccharomyces cerevisiae constitutive promoter TYS1p gene sequence from the Genbank gene bank, extract the Saccharomyces cerevisiae genome, and amplify to obtain the TYS1p gene fragment.

[0018] The primer sequences are:

[0019] Primer 1: 5'> ACGCGTCGAC TCCTTGCGCTTACTCGAATA<3', the underlined sequence is the overlapping sequence with the Sal I restriction site.

[0020] Primer 2: 5'> GGGACAACTCCAGTGAAAAGTTCTTCTCCCTTGCTCACCAT TGTTATCGTCAATTAGAG<3', the underlined sequence is the overlapping sequence with the reporter gene eGFP.

[0021] Step 2. Obtain the reporter gene eGFP fragment from the Genbank gene bank, and amplify the eGFP gene fragment after chemical synthesis.

[0022] The primer sequences are:

[0023] Primer 4: 5'> TCCATAACCGCATACTTCTAATTGACGATAACA ATGGTGAGCAAGGGAGAAGAACTTTTC<3', the underlined sequence is the overlapping sequence with the promoter TYS1p.

[0...

Embodiment 2

[0027] Embodiment 2: Construction of terminator library

[0028] Step 1: Query the Saccharomyces cerevisiae genome sequence in the NCBI database, obtain the 3'-UTR terminator sequence information downstream of the Saccharomyces cerevisiae structural gene through bioinformatics analysis, design primers, and amplify to obtain the terminator. Taking the terminator TPS1t as an example, the 3'-UTR terminator gene sequence of the TPS1t structural gene was obtained from the NCBI database, and primers were designed to amplify the gene fragment of the terminator TPS1t.

[0029] The primer sequences are:

[0030] Primer 14: 5'> CCTGGGATTACACATGGCATGGATGAACTATACAAATAAATGAACCCGATGCAAATGAG <3', the underlined sequence is the overlapping sequence with the eGFP reporter gene.

[0031] Primer 15: 5'> GCTCCACCGCGGTGGCGGCCGCTCTAGAACTAGTGGATCTTTTTGTCTTTCTTCAAATTG <3', the underlined sequence is the overlapping sequence with the pRS41H plasmid.

[0032] Step 2: Pick a single colony of Esche...

Embodiment 3

[0040] Example 3: The regulatory effect of terminators on the expression intensity of fluorescent proteins

[0041] Saccharomyces cerevisiae transformants containing different terminator expression vectors were randomly selected from the terminator library, inoculated in 10 mL medium containing 2% glucose, 2% peptone and 1% yeast powder, and cultured with shaking at 30°C and 200rpm for 36 hours. The fluorescence intensity of intracellular eGFP was detected by flow cytometry, and the fluorescence intensity of Saccharomyces cerevisiae CEN.PK2-1C was used as a blank, and the fluorescence intensity of the terminator PGK1t was used as a reference. It was found that the terminator can effectively regulate yeast gene expression at the translation level (see attached figure 2 ), the order of fluorescent protein expression intensity as terminator RAD14t, TDH3t, SDH1t, NTA1t, MMS22t, SOR1t, TPS1t, ATP15t and ELO2t is:

[0042] RAD14t

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The application discloses a method for regulating and controlling the expression level of saccharomyces cerevisiae genes by using terminators and belongs to the field of bioengineering. The method comprises the following steps: firstly, constructing a terminator verification carrier containing a promoter and a reporter gene; analyzing sequence information of 3'-UTR (Untranslated Region) terminators on the downstreams of saccharomyces cerevisiae structural genes by bioinformatics, amplifying the terminators and connecting the amplified terminator with the terminator verification carrier to form a terminator library. By replacing or changing the terminators in a gene expression cassette, regulation and control of the expression level of target genes or pathways can be realized from the transcription and translation levels; the method provides an efficient fine regulation and control means for optimizing a metabolic pathway of yeast, and facilitates efficient and balanced expression of exogenous genes or pathways in yeast cells.

Description

technical field [0001] The invention relates to a method for regulating yeast gene expression intensity by using a terminator, which belongs to the field of bioengineering. Background technique [0002] Saccharomyces cerevisiae, as a traditional industrial microorganism, can produce high-value natural products, biofuels, chemical products and materials in a safe and reliable manner, and has been able to synthesize artemisinin precursors in it by introducing new functional gene modules or new synthetic pathways Artemisinic acid, ginsenosides, butanol derivatives and other complex compounds. However, due to the multi-level influence of exogenous genes in yeast cells such as transcriptional regulation, post-translational modification, and metabolic network coordination, the expression effect of exogenous genes or pathways in yeast cells is limited, resulting in imbalanced metabolic flow and other problems. Finally, the production concentration of the target product is limited,...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/81C12N15/113
CPCC12N15/81C12N15/113C12N2830/36
Inventor张根林魏琳娜王婷
OwnerSHIHEZI UNIVERSITY