Nano influenza vaccine, construction method and application
A nano and recombinant protein technology, applied in chemical instruments and methods, biochemical equipment and methods, pharmaceutical formulations, etc., can solve problems such as difficulty in timely production of vaccines, and achieve simplified vaccine preparation process, improved immunogenicity, and less damage. Effect
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Publication Date
- 2017-11-14
Smart Images

Figure 1 
Figure 2 
Figure 3
Abstract
Description
technical field
[0001] The present invention relates to the technical field of vaccine manufacture, and more specifically relates to a nano-influenza vaccine, which can significantly enhance M2e immunogenicity, Nano-influenza vaccines with cross-protective efficacy. Background technique
[0002] Influenza virus is a relatively common respiratory virus that endangers human health. Seasonal influenza causes about 3 to 5 million illnesses and 250,000 to 500,000 deaths in the world every year. The emergence and prevalence of potential new influenza virus strains pose a great threat to human health.
[0003] Currently, vaccination is the most effective way to prevent influenza. Influenza vaccines in use are mainly inactivated, attenuated or recombinant trivalent and quadrivalent influenza vaccines, which can improve the body's ability to resist influenza virus infection by inducing specific antibodies against the main antigen HA or NA of influenza virus. Due to the continuous ...
Examples
Embodiment 1
[0036] The preparation method of 3M2e-rHF nano flu vaccine, its steps are:
[0037] (1) Construct the 3M2e-rHF protein expression plasmid pET28a / 3M2e-rHF:
[0038] PCR amplification of rHF sequence: using the plasmid pET-rHF encoding human ferritin H chain sequence (rHF) (gifted by Dr PaoloSantambrogio (Milan, Italy)) as a template (Nanoscale, 2012, 4, 188), sense primer: 5'CCGGTGTAATGGAAGCTCCGACGGAGGAGGAGGATCTATGACGACCGCGTCCACCTC 3 ', reverse primer: 5' CCGCTCGAGTTAGCTTTTCATTATCACTGTC 3';
[0039] 3M2e sequence: The nucleic acid sequence of M2e (Gene ID: 956528) was found in NCBI, and the 3M2e sequence was chemically synthesized. Using the synthetic 3M2e nucleic acid sequence as a template, sense primer: 5'GGGAATTCCATATGATGTCTCTGCTGACCGAGG 3', reverse primer: 5'GAGGTGGACGCGGTCGTCATAGATCCTCCTCCTCCGTCGGAGCTTCCATTACACC 3', the amino acid sequence of M2e is MSLLTEVETPIRNEWGCRCNGSSD, and the sequence of influenza virus in A / Puerto Rico / 8 / 34 (H1N2e) unanimous.
[0040]Using the ...
Embodiment 2
[0044] The verification of the immune effect of 3M2e-rHF nanoparticle influenza vaccine in mice, the steps are as follows:
[0045] (1) Balb / c mice aged 6 to 8 weeks were randomly divided into groups, and 10 μg of 3M2e-rHF nanoparticles, 2.6 μg of 3M2e synthetic peptides (compared with 3M2e-rHF nanoparticles containing equimolar M2e), Balb / c mice were immunized with 6.3 μg of rHF nanoparticles (compared with 3M2e-rHF nanoparticles containing equimolar rHF) and PBS via intranasal route for three times, with an interval of three days between two adjacent immunizations. week. Mouse serum was collected two weeks after each immunization, stored at -20°C, and ELISA was used to detect M2e-specific antibodies. Antibody detection results showed that after three immunizations, the 3M2e polypeptide and rHF nanoparticles immunized mice were the same as the PBS control mice, and M2e-specific IgG antibodies were not detected in the serum, while 3M2e-rHF nanoparticles induced a large amount...