Nano influenza vaccine, construction method and application

A nano and recombinant protein technology, applied in chemical instruments and methods, biochemical equipment and methods, pharmaceutical formulations, etc., can solve problems such as difficulty in timely production of vaccines, and achieve simplified vaccine preparation process, improved immunogenicity, and less damage. Effect

Active Publication Date: 2017-11-14
WUHAN INST OF VIROLOGY CHINESE ACADEMY OF SCI
View PDF5 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

During seasonal influenza epidemics or influenza outbreaks, it is difficult to produce sufficient vaccines in time

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Nano influenza vaccine, construction method and application
  • Nano influenza vaccine, construction method and application
  • Nano influenza vaccine, construction method and application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0036] The preparation method of 3M2e-rHF nano flu vaccine, its steps are:

[0037] (1) Construct the 3M2e-rHF protein expression plasmid pET28a / 3M2e-rHF:

[0038] PCR amplification of rHF sequence: using the plasmid pET-rHF encoding human ferritin H chain sequence (rHF) (gifted by Dr PaoloSantambrogio (Milan, Italy)) as a template (Nanoscale, 2012, 4, 188), sense primer: 5'CCGGTGTAATGGAAGCTCCGACGGAGGAGGAGGATCTATGACGACCGCGTCCACCTC 3 ', reverse primer: 5' CCGCTCGAGTTAGCTTTTCATTATCACTGTC 3';

[0039] 3M2e sequence: The nucleic acid sequence of M2e (Gene ID: 956528) was found in NCBI, and the 3M2e sequence was chemically synthesized. Using the synthetic 3M2e nucleic acid sequence as a template, sense primer: 5'GGGAATTCCATATGATGTCTCTGCTGACCGAGG 3', reverse primer: 5'GAGGTGGACGCGGTCGTCATAGATCCTCCTCCTCCGTCGGAGCTTCCATTACACC 3', the amino acid sequence of M2e is MSLLTEVETPIRNEWGCRCNGSSD, and the sequence of influenza virus in A / Puerto Rico / 8 / 34 (H1N2e) unanimous.

[0040]Using the ...

Embodiment 2

[0044] The verification of the immune effect of 3M2e-rHF nanoparticle influenza vaccine in mice, the steps are as follows:

[0045] (1) Balb / c mice aged 6 to 8 weeks were randomly divided into groups, and 10 μg of 3M2e-rHF nanoparticles, 2.6 μg of 3M2e synthetic peptides (compared with 3M2e-rHF nanoparticles containing equimolar M2e), Balb / c mice were immunized with 6.3 μg of rHF nanoparticles (compared with 3M2e-rHF nanoparticles containing equimolar rHF) and PBS via intranasal route for three times, with an interval of three days between two adjacent immunizations. week. Mouse serum was collected two weeks after each immunization, stored at -20°C, and ELISA was used to detect M2e-specific antibodies. Antibody detection results showed that after three immunizations, the 3M2e polypeptide and rHF nanoparticles immunized mice were the same as the PBS control mice, and M2e-specific IgG antibodies were not detected in the serum, while 3M2e-rHF nanoparticles induced a large amount...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a nano influenza vaccine, a construction method and application. The nano influenza vaccine is a recombinant protein 3M2e-rHF and has a sequence shown in SEQ ID No. 2. According to the recombinant protein disclosed by the invention, 3M2e is displayed on the surface of a cage structure of ferritin, so that the immunogenicity of M2e is remarkably improved, and thus, a novel influenza vaccine, i.e., nanoparticles 3M2e-rHF is constructed. According to the nano influenza vaccine, the construction method and the application, a recombinant protein vaccine is expressed by using a procaryotic expression system, i.e., Escherichia coli, and no live virus is involved in a vaccine preparation process, so that compared with the traditional methods for preparing influenza vaccines from chick embryos, the method has the advantages of being safer, simpler and more convenient in operation and being suitable for carrying out rapid large-scale production; by using the high sequence conservation of the M2e in different subtype influenza viruses, proven by experiments, the 3M2e-rHF protects mice from resisting the infection of homotype and heterotype influenza viruses, thereby being advantageously developed into general influenza vaccines with cross protection potency.

Description

technical field [0001] The present invention relates to the technical field of vaccine manufacture, and more specifically relates to a nano-influenza vaccine, which can significantly enhance M2e immunogenicity, Nano-influenza vaccines with cross-protective efficacy. Background technique [0002] Influenza virus is a relatively common respiratory virus that endangers human health. Seasonal influenza causes about 3 to 5 million illnesses and 250,000 to 500,000 deaths in the world every year. The emergence and prevalence of potential new influenza virus strains pose a great threat to human health. [0003] Currently, vaccination is the most effective way to prevent influenza. Influenza vaccines in use are mainly inactivated, attenuated or recombinant trivalent and quadrivalent influenza vaccines, which can improve the body's ability to resist influenza virus infection by inducing specific antibodies against the main antigen HA or NA of influenza virus. Due to the continuous ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C07K19/00C12N15/62C12N15/70A61K39/145A61P31/16
CPCA61K39/145C07K14/00C07K14/11C07K2319/00C12N2760/16034
Inventor崔宗强陈建军齐咪张先恩
OwnerWUHAN INST OF VIROLOGY CHINESE ACADEMY OF SCI