Application of EMP gene in differentiation and development of rice callus

A technology of gene expression level and rice, which is applied in application, genetic engineering, plant gene improvement, etc., can solve the problems of low transformation efficiency, large impact on transformation efficiency, and large difference in callus regeneration ability, so as to improve the genetic transformation of rice. efficiency, improving transformation efficiency, and improving the effect of rice callus differentiation ability

Inactive Publication Date: 2017-11-21
SOUTH CHINA AGRI UNIV
View PDF2 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0003] In the process of plant tissue culture, the difference of plant genotype has a great influence on the transformation efficiency. For example, the callus regeneration ability of rice indica and japonica rice is quite different. At present, the improvement of the extremely low transformation efficiency caused by the low regeneration ability of indica rice focuses on the medium reagent The adjustment of components, and only a small number of successful reports, shows that the improvement of its regeneration ability cannot only rely on the improvement of callus regeneration medium

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of EMP gene in differentiation and development of rice callus
  • Application of EMP gene in differentiation and development of rice callus

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0027] Example 1 Obtaining of RNA Interference Mutant Material of Rice Affecting Callus Differentiation Ability-Related Gene EMP

[0028] Design specific primers according to the sequence information of NCBI database Os05g0349800:

[0029] SEQ ID NO: 3:

[0030] CTAGTCGACTCTAGCCTCGAGATGGCGTCCGGGCAGCAG

[0031] SEQ ID NO: 4: ATCTGCTCCTTCCTCGTCT

[0032] SEQ ID NO: 5: GGAGGCCTGGATCGACTAGTATGGCGTCCGGGCAGCAG

[0033] SEQ ID NO: 6: AGACGAGGAAGGAGCAGATCTCGGCGAGGTTCTCCTG

[0034] Utilize the combination of primers SEQ ID NO: 3 and SEQ ID NO: 4 and the combination of SEQ ID NO: 5 and SEQ ID NO: 6 to amplify the two DNA fragments and use one-step construction of RNA interference carrier method (Jiang, et al., Planta. 2013. (238): 325-330) Construction of pER8 estrogen-inducible RNA interference vector (Zuo J, et al., 2000. 11(2): 146-151.). Zhonghua 11 was transformed by Agrobacterium-mediated transformation method, and a stable transgenic line was obtained. Compared with Zhonghua...

Embodiment 2

[0035] Example 2 Functional Identification of Genes Related to Rice Affecting Callus Differentiation Ability

[0036] 1. Rice RNA extraction and reverse transcription reaction

[0037] (1) Take about 0.5 g of rice (Zhonghua 11) tissue, put it into a pre-cooled mortar, add liquid nitrogen, grind it into powder, put it into a 2 mL centrifuge tube, add 1000 μL RNA extraction buffer and 200 μL chloroform, mix well, and bathe in water at 65°C for 5 minutes;

[0038] (2) Centrifuge at 12,000 rpm for 12 minutes, transfer the supernatant to another 1.5mL centrifuge tube, add 0.6 times the volume of isopropanol or twice the volume of absolute ethanol, mix well, 12,000 rpm Centrifuge for 12 minutes, remove the supernatant, rinse twice with 0.5ml 70% ethanol, air dry, and dissolve in 20 μL DEPC water;

[0039] (3) Take 1 μL of RNA for PCR reverse transcription reaction to synthesize the first strand of reverse transcription cDNA (15 μL). The reaction system is: 1 μL of DNase-treated to...

Embodiment 3

[0063] Example 3 Functional Verification of Genes Affecting Rice Callus Differentiation Ability

[0064] Estrogen is used to induce the expression of RNA interference products and destroy the gene sequence of SEQ ID NO: 1 in rice. Real-time quantitative RT-PCR detection showed that the mRNA expression level decreased, and the pre-differentiation ability of estrogen-treated RNAi interference mutants decreased significantly.

[0065] The functional verification of genes related to rice callus differentiation ability includes the following steps:

[0066] (1) Using estrogen-induced expression vectors to construct RNA interference vectors for genes related to rice callus differentiation ability, and transform Zhonghua 11 through Agrobacterium-mediated transformation and identify homozygous transgenic T2 generation materials.

[0067] (2) The seeds of Zhonghua 11 and RNA interference transgenic materials affecting rice callus differentiation ability-related genes were used to indu...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention belongs to the field of plant genetic engineering, and discloses an EMP gene for influencing differentiation and development of a rice callus and application of EMP gene in differentiation and development of the rice callus. The nucleotide sequence of the EMP gene is shown as SEQ ID NO:1; the EMP gene is related to the differentiation and development of the rice callus, and the regeneration capacity of the rice callus can be quickly detected and identified by detecting the expression quantity of the EMP gene; and moreover, through overexpression of the EMP gene, the differentiation capacity of the rice callus can be improved, the genetic transformation efficiency of rice is improved, and then the transgenosis transformation efficiency of agrobacterium-induced rice is improved, and the application is of great importance in breeding new rice varieties.

Description

technical field [0001] The invention belongs to the technical field of plant genetic engineering, and more specifically relates to a EMP Application of genes in callus differentiation and development in rice. Background technique [0002] Agrobacterium-mediated plant transgenic technology is widely used in the study of plant gene function and crop genetic improvement. The Agrobacterium-mediated method mainly uses the meristem and reproductive organs of the plant as the receptors for exogenous gene introduction, and makes the Agrobacterium contact with the receptor material through vacuum infiltration method, dipping method and injection method to complete the heritability. The cells are transformed, and then the transgenic plants are cultivated by tissue culture, and the progeny of the transgenic plants are identified by antibiotic screening and molecular detection. The Agrobacterium-mediated method has the advantages of high efficiency, low cost, and the ability to transf...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/29C07K14/415C12N15/82A01H5/00C12Q1/68
CPCC07K14/415C12N15/8205C12N15/8261C12Q1/6895C12Q2600/13C12Q2600/158
Inventor 张群宇贾春阳周峰刘耀光王曼江燕翔赵秀彩谢敏祝钦泷
Owner SOUTH CHINA AGRI UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap