A method for enzymatically synthesizing 3-o-glucosylglycyrrhetinic acid

A glycyrrhetic acid and glucose-based technology, which is applied in the field of synthesizing 3-O-glucosylglycyrrhetic acid, can solve the problems of harsh reaction conditions, cumbersome reaction steps, reduced yield and the like, and achieves mild reaction conditions and high catalytic efficiency. Effect

Active Publication Date: 2022-02-18
BEIJING INSTITUTE OF TECHNOLOGYGY
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

In this process, the reaction steps are cumbersome, the reaction conditions are harsh, it takes a long time and the yield is reduced, and the reaction often requires a large amount of toxic and harmful solvents, causing environmental pollution

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A method for enzymatically synthesizing 3-o-glucosylglycyrrhetinic acid
  • A method for enzymatically synthesizing 3-o-glucosylglycyrrhetinic acid
  • A method for enzymatically synthesizing 3-o-glucosylglycyrrhetinic acid

Examples

Experimental program
Comparison scheme
Effect test

experiment example 1

[0036] Experimental Example 1: Synthesis of 3-O-glucosylglycyrrhetinic acid glycosyltransferase gene acquisition

[0037] A: The acquisition of glycosyltransferase Unigene14953 and Unigene20323 genes

[0038] According to the screening of the licorice transcriptome database, the glycosyltransferase genes Unigene14953 and Unigene20323 were obtained, and the primers were designed:

[0039] 53-F: 5'>ATGGACGTTG CTGAAGAACA GCC<3' (as shown in SEQ ID No.11);

[0040] 53-R: 5'>TTAGTTAAGC TGCTTAGAGT CTCTC<3' (as shown in SEQ ID No.12);

[0041] 23-F: 5'>ATGGTTTTCCAAAGCAAACCAACC<3' (as shown in SEQ ID No.13);

[0042]23-R: 5'>AGTTTCAACT TTACTACTTG ATTGT<3' (as shown in SEQ ID No.14);

[0043] Uralia licorice cDNA was used as a template, and ExTaq enzyme was used for PCR amplification to obtain the Unigene14953 gene of 1434bp fragment and the Unigene20323 gene of 1470bp fragment respectively, which were cloned into the pMD19-T vector as shown in SEQ ID No.1 and SEQ ID No.3 , the com...

Embodiment 2

[0053] Embodiment 2: Construct the Escherichia coli engineered bacterium containing glycosyltransferase

[0054] Construct Escherichia coli engineering bacteria E.coli BL21(DE3) / pET28a-UGT73C11 containing the glycosyltransferase UGT73C11 gene, chemically synthesize the glycosyltransferase UGT73C11 gene fragment (shown in SEQ ID No.8) as a template, and design upstream and downstream primers And add restriction sites EcoRI, SalI and protective bases:

[0055] E-C11-F: 5'>CCGGAATTCATGGTTTCTGAAATCACCCACAAAT<3' (as shown in SEQ ID No.19); with an EcoRI restriction site.

[0056] E-C11-R: 5'>ACGCGTCGACGTTGTTAGACTGAGCCAGCTGCATGAT<3' (as shown in SEQ ID No.20); with a SalI restriction site.

[0057] The PCR reaction system is: 1 μL of template, 2 μL of upstream and downstream primers, 25 μL of Primer star mix (Bao Biological Company), and less than 50 μL of double distilled water. PCR reaction conditions: pre-denaturation at 98°C for 1min, denaturation at 98°C for 10s, annealing at...

Embodiment 3

[0071] Embodiment 3: the fermentation of escherichia coli genetic engineering bacterium

[0072] (1) Pick and identify the correct Escherichia coli engineering bacteria and inoculate them in LB liquid medium (peptone 10g / L, yeast extract 5g / L, sodium chloride 10g / L) containing 100mg / L kanamycin for overnight culture , culture conditions 37°C, 170rpm.

[0073] (2) Inoculate 3 ml of the overnight cultured bacterial liquid into 300 ml LB liquid medium containing 100 mg / L kanamycin and cultivate for 3-5 hours until OD600=0.6, the culture condition is 37° C., 170 rpm.

[0074] (3) Add the inducer IPTG to make the final concentration 0.5mM / L, continue to cultivate, and the culture conditions are changed to 16°C, 170rpm, 8-10h.

[0075] (4) Centrifuge the obtained fermentation broth at room temperature at 8000 g for 10 min, and collect the bacteria.

[0076] (5) 25ml of 50mM PBS buffer solution with pH 7.0 was used to resuspend the bacteria, and the bacteria were lysed with a low-t...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a method for enzymatically synthesizing 3-O-glucosylglycyrrhetinic acid, which belongs to the field of bioengineering and technology. The present invention clones or chemically synthesizes the glycosyltransferase genes Unigene14953, Unigene20323UGT73C11, UGT73C5 and UGT73C6 from plants Glycyrrhiza thaliana, European mountain thaliana or Arabidopsis, preferably Escherichia coli as a host bacterium, and constructs a genetically engineered bacterium containing glycosyltransferase. 3-O-glucosylglycyrrhetinic acid can be efficiently synthesized by using recombinant glycosyltransferase to act on the substrates glycyrrhetinic acid and uridine diphosphate glucose under the conditions of pH 5.0-11.0 and temperature 25-55°C.

Description

Technical field: [0001] The invention relates to a method for synthesizing 3-O-glucosylglycyrrhetinic acid, which belongs to the field of bioengineering and technology. Background technique: [0002] Glycyrrhetinic acid is a pentacyclic triterpenoid oleanane-type natural product, mainly derived from the rhizome of the plant licorice. Glycyrrhetinic acid has a variety of pharmacological and biological activities, so it is widely used in the field of medicine. In the field of clinical medicine, it is widely used because of its anti-tumor, anti-inflammatory, anti-viral, anti-ulcer, anti-allergic, anti-oxidation and adrenocortical hormone-like pharmacological effects. Glycyrrhetinic acid can also combine with liver cells to inhibit liver cell apoptosis and cell necrosis. However, because of its structural characteristics, glycyrrhetinic acid often encounters problems such as hyperaldosteronism, poor water solubility, and low bioavailability in clinical application. Therefore,...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): C12N9/10C12N15/54C12P33/20
CPCC12N9/1048C12P33/20
Inventor李春刘啸尘张良倪江平刘护
OwnerBEIJING INSTITUTE OF TECHNOLOGYGY