Method for synthesizing trans-4-hydroxy-L-proline by virtue of escherichia coli

A technology of Escherichia coli and proline, applied in the fields of synthetic biology, medicinal chemistry, and microbial genetic engineering, can solve the problem of low HYP production, achieve rapid growth, increase production, and easy genetic manipulation

Pending Publication Date: 2018-03-16
CHENGDU INST OF BIOLOGY CHINESE ACAD OF S
View PDF1 Cites 6 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0011] Although the above-mentioned literature has realized the production of target product without adding substrates, the yield of HYP is not too high

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for synthesizing trans-4-hydroxy-L-proline by virtue of escherichia coli
  • Method for synthesizing trans-4-hydroxy-L-proline by virtue of escherichia coli
  • Method for synthesizing trans-4-hydroxy-L-proline by virtue of escherichia coli

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0056] Embodiment 1: Drawing of L-proline standard curve

[0057] The L-proline standard substance with a concentration of 1g / L was serially diluted to 250mg / L, 125mg / L, 75mg / L, 37.5mg / L, 18.75mg / L, 9.375mg / L, 4.687mg / L L, the concentration of 2.344mg / L and 1.172mg / L, with H 2 O is used as a blank control, and the absorbance values ​​at 520 nm corresponding to different concentrations of L-proline are measured according to the ninhydrin method. Draw the standard curve, calculate the standard curve formula and R 2 value. Such as figure 2 As shown, the content of proline was calculated with the formula fitted by the standard curve.

Embodiment 2

[0058] Embodiment 2: Drawing of trans-4-hydroxyl-L-proline standard curve

[0059]The trans-4-hydroxy-L-proline standard substance with a concentration of 1g / L was serially diluted to 0.2mg / L, 0.5mg / L, 1mg / L, 2mg / L, 3mg / L, 4mg / L, 5mg / L concentration, with H 2 O is used as a blank control, and the absorbance values ​​at 560 nm corresponding to different concentrations of trans-4-hydroxyl-L-proline are measured according to the chloramine T method. Draw the standard curve, calculate the standard curve formula and R 2 value. Such as image 3 As shown, the content of trans-4-hydroxyl-L-proline was calculated by the formula fitted by the standard curve.

Embodiment 3

[0060] Embodiment 3: the construction of Escherichia coli MG1655 (ΔputA) host bacteria

[0061] Competent cells of Escherichia coli MG1655 were prepared with 10% glycerol, transformed into pKD46 plasmid, cultured on an ampicillin plate at 30°C overnight, and positive clones were screened. Then use positive clones to prepare competent cells: when the bacteria grow to OD 600nm When =0.2~0.3, add L-arabinose (30mM), induce for 1 hour at 30°C to express λ-red recombinant protein (exo, bet, gram), and harvest the bacteria to make MG1655 (pKD46) competent cells. Design primers with ~50bp homology arms upstream and downstream of the putA gene (Gene ID: 945600) coding region, the primers are:

[0062] putA-Ecoli-H1P1:GACCACGTTAAAGATGCCGGAGGAGGTTGTAACATCCTCCGGCTACCTGTAGCGATTGTGTAGGCTGGAG;

[0063] putA-Ecoli-H2P2:ACGATAACGTTAAGTTGCACCTTTCTGAACAACAGGAGTAATGGCATGGGAATTAGCCATGGTCC.

[0064] It is used to amplify the sequence between priming site 1 and 2 on pKD4, recover the amplified D...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the field of medical chemistry, and aims at providing a method for synthesizing trans-4-hydroxy-L-proline. According to the technical scheme, by virtue of genetiuc engineeringmodified escherichia coli, [alpha]-ketoglutaric acid, which is generated from autologous TCA circulation of a catalysis host, is converted into an L-proline gene, and the L-proline gene undergoes tandem and over-expression, so that the yield of L-proline is improved; and prolyl hydroxylase is introduced, so that a reaction that the L-proline is converted into the trans-4-hydroxy-L-proline and a reaction that the [alpha]-ketoglutaric acid is converted into succinic acid are coupled; therefore, the efficient synthesis of the trans-4-hydroxy-L-proline under a condition of not adding exogenous L-proline is achieved. The synthesis method of the trans-4-hydroxy-L-proline provided by the invention is optimized, so that the yield of the target product (the trans-4-hydroxy-L-proline) is greatly improved.

Description

technical field [0001] The invention belongs to the fields of medicinal chemistry, synthetic biology and microbial genetic engineering; it relates to a method for synthesizing trans-4-hydroxyl-L-proline, in particular to Escherichia coli transformed by genetic engineering, without adding L-proline A method for efficiently biosynthesizing trans-4-hydroxyl-L-proline under the condition of amino acid. Background technique [0002] Trans-4-hydroxy-L-proline (trans-4-hydroxy-L-proline, referred to as HYP, Chinese abbreviation: hydroxyproline, is the 4-hydroxylation product of L-proline, is the collagen The main constituent amino acids are widely used in medicine, chemical industry, feed, food nutrition and beauty and other industries: it is an important chiral synthon, such as used as a drug synthesis intermediate for the synthesis of carbapenem antibiotics and angiotensin transformation Enzyme inhibitors, etc.; it is an important raw material for the synthesis of polypeptide dr...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N1/21C12N15/70C12P13/24C12N15/53C12R1/19
CPCC12N9/0071C12N15/70C12N2800/22C12P13/24C12Y114/11002
Inventor罗应刚姜良珍张国林
OwnerCHENGDU INST OF BIOLOGY CHINESE ACAD OF S