Primer pairs for rapid detection of toxoplasmosis nucleic acid, kit and detection method
A technology for detection kits and detection primers, applied in biochemical equipment and methods, recombinant DNA technology, microbial measurement/inspection, etc., can solve problems such as false positives, complicated detection steps, aerosol pollution, etc., and achieve high accuracy , reduce the risk of pollution, the effect of low equipment requirements
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0087] Embodiment 1, rapid detection of Toxoplasma gondii nucleic acid
[0088] Toxoplasma gondii rapid detection kit was used for rapid detection of toxoplasma gondii. Described toxoplasma gondii nucleic acid rapid detection kit comprises:
[0089] 1. Lysis buffer 500μL;
[0090]
[0091] 2. Diluent rehydrate buffer 1.8ml;
[0092] Each 80ml diluent contains:
[0093]
[0094] 3. 4ml lyophilized enzyme tube containing primers;
[0095]
[0096]
[0097] Wherein, the sequences of primer pairs and probes are as follows:
[0098] The upstream primer is: 5'-TTGCTGTTCTGTCCTATCGC-3'.
[0099] The downstream primer is: 5'-ATGTTGCATTCTTCAGCCGTCT-3.
[0100] The probe is: TCCCATGAAGTCGACCACCTGTTTCCTC / i6-FAMdT / / idSp / / iBHQ1dT / TCACTGTCA-C3 Spacer.
[0101] 4. The negative control substance is the RNase-free water blank control.
[0102] 5. The positive control substance is a plasmid containing a target gene sequence at a concentration of 1 pg / μL. The target gene sequenc...
Embodiment 2
[0110] Embodiment 2, the detection of clinical sample:
[0111] Toxoplasma gondii nucleic acid rapid detection kit was used for rapid detection of Toxoplasma gondii clinical samples. Described toxoplasma gondii nucleic acid rapid detection kit comprises:
[0112] 1. Lysis buffer 500uL;
[0113]
[0114] 2. Diluent rehydrate buffer 1.8ml;
[0115] Each 80ml diluent contains:
[0116]
[0117]
[0118] 3. 4ml lyophilized enzyme tube containing primers;
[0119]
[0120] Wherein, the sequences of primer pairs and probes are as follows:
[0121] The upstream primer is: 5'-TTGCTGTTCTGTCCTATCGC-3'.
[0122] The downstream primer is: 5'-ATGTTGCATTCTTCAGCCGTCT-3.
[0123] The probe is: TCCCATGAAGTCGACCACCTGTTTCCTC / i6-FAMdT / / idSp / / iBHQ1dT / TCACTGTCA-C3 Spacer.
[0124] 4. The negative control substance is the RNase-free water blank control.
[0125] 5. The positive control substance is a plasmid containing a target gene sequence at a concentration of 1 pg / μL. The tar...
Embodiment 3
[0134] Embodiment 3, cross reaction detection
[0135] Canine distemper virus, canine parvovirus, canine adenovirus type 1, canine adenovirus type 2, canine parainfluenza virus, canine leptospira, and canine coronavirus nucleic acid, with Toxoplasma positive samples as controls, for specific detection , the result is as figure 2 As shown, among them, only the positive sample of Toxoplasma gondii is a typical "S" curve, which is a positive result, and the other samples are all horizontal lines, which is a negative result. The results show that except for the positive samples of toxoplasma gondii, the results of other samples are all negative, which proves that the present invention has no cross-reaction with other pet infectious disease pathogenic nucleic acids.
[0136] The present invention uses the B1 gene sequence of the Toxoplasma gondii genome as the target gene, screens the best primers, and cooperates with enzymes and various reagents at the optimum concentration and ...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


