Check patentability & draft patents in minutes with Patsnap Eureka AI!

Primer pairs for rapid detection of toxoplasmosis nucleic acid, kit and detection method

A technology for detection kits and detection primers, applied in biochemical equipment and methods, recombinant DNA technology, microbial measurement/inspection, etc., can solve problems such as false positives, complicated detection steps, aerosol pollution, etc., and achieve high accuracy , reduce the risk of pollution, the effect of low equipment requirements

Inactive Publication Date: 2018-04-17
SUZHOU CLICKGENE BIOTECH CO LTD
View PDF6 Cites 16 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0006] Chinese patent CN201610867186.X discloses a rapid detection method of Toxoplasma gondii nucleic acid and its rapid detection kit. The detection method requires additional nucleic acid extraction steps, and the detection steps are relatively complicated, which is likely to cause aerosol pollution and introduce false positives. positive risk

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Primer pairs for rapid detection of toxoplasmosis nucleic acid, kit and detection method
  • Primer pairs for rapid detection of toxoplasmosis nucleic acid, kit and detection method
  • Primer pairs for rapid detection of toxoplasmosis nucleic acid, kit and detection method

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0087] Embodiment 1, rapid detection of Toxoplasma gondii nucleic acid

[0088] Toxoplasma gondii rapid detection kit was used for rapid detection of toxoplasma gondii. Described toxoplasma gondii nucleic acid rapid detection kit comprises:

[0089] 1. Lysis buffer 500μL;

[0090]

[0091] 2. Diluent rehydrate buffer 1.8ml;

[0092] Each 80ml diluent contains:

[0093]

[0094] 3. 4ml lyophilized enzyme tube containing primers;

[0095]

[0096]

[0097] Wherein, the sequences of primer pairs and probes are as follows:

[0098] The upstream primer is: 5'-TTGCTGTTCTGTCCTATCGC-3'.

[0099] The downstream primer is: 5'-ATGTTGCATTCTTCAGCCGTCT-3.

[0100] The probe is: TCCCATGAAGTCGACCACCTGTTTCCTC / i6-FAMdT / / idSp / / iBHQ1dT / TCACTGTCA-C3 Spacer.

[0101] 4. The negative control substance is the RNase-free water blank control.

[0102] 5. The positive control substance is a plasmid containing a target gene sequence at a concentration of 1 pg / μL. The target gene sequenc...

Embodiment 2

[0110] Embodiment 2, the detection of clinical sample:

[0111] Toxoplasma gondii nucleic acid rapid detection kit was used for rapid detection of Toxoplasma gondii clinical samples. Described toxoplasma gondii nucleic acid rapid detection kit comprises:

[0112] 1. Lysis buffer 500uL;

[0113]

[0114] 2. Diluent rehydrate buffer 1.8ml;

[0115] Each 80ml diluent contains:

[0116]

[0117]

[0118] 3. 4ml lyophilized enzyme tube containing primers;

[0119]

[0120] Wherein, the sequences of primer pairs and probes are as follows:

[0121] The upstream primer is: 5'-TTGCTGTTCTGTCCTATCGC-3'.

[0122] The downstream primer is: 5'-ATGTTGCATTCTTCAGCCGTCT-3.

[0123] The probe is: TCCCATGAAGTCGACCACCTGTTTCCTC / i6-FAMdT / / idSp / / iBHQ1dT / TCACTGTCA-C3 Spacer.

[0124] 4. The negative control substance is the RNase-free water blank control.

[0125] 5. The positive control substance is a plasmid containing a target gene sequence at a concentration of 1 pg / μL. The tar...

Embodiment 3

[0134] Embodiment 3, cross reaction detection

[0135] Canine distemper virus, canine parvovirus, canine adenovirus type 1, canine adenovirus type 2, canine parainfluenza virus, canine leptospira, and canine coronavirus nucleic acid, with Toxoplasma positive samples as controls, for specific detection , the result is as figure 2 As shown, among them, only the positive sample of Toxoplasma gondii is a typical "S" curve, which is a positive result, and the other samples are all horizontal lines, which is a negative result. The results show that except for the positive samples of toxoplasma gondii, the results of other samples are all negative, which proves that the present invention has no cross-reaction with other pet infectious disease pathogenic nucleic acids.

[0136] The present invention uses the B1 gene sequence of the Toxoplasma gondii genome as the target gene, screens the best primers, and cooperates with enzymes and various reagents at the optimum concentration and ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a primer pairs for rapid detection of toxoplasmosis nucleic acid, a kit and a detection method. The primer pairs for rapid detection of toxoplasmosis nucleic acid comprises aforward primer, a reverse primer and a probe for detecting genome B1 gene sequence of toxoplasmosis. The kit comprises the following contents: a lysate, a diluent, a lyophozyme tube containing the primers, a positive quality control and a negative quality control. The detection includes the process of carrying out a normal-temperature nucleic acid amplification technology by using the kit. Throughmultiple enzymatic reactions of DNA helicase, single-stranded DNA binding protein, DNA polymerase and the like, target DNA can be amplified by millions of times under the condition of constant temperature 37-45 DEG C within 10-30 min; and with the cooperation of the fluorescence detection technique, rapid detection of DNA to be tested can be realized. The detection method of the invention has advantages of simple operation, short time and low requirement on equipment, and is very suitable for rapid diagnosis of pet infectious diseases.

Description

technical field [0001] The invention relates to the field of biotechnology, in particular to a primer set, kit and detection method for rapid detection of Toxoplasma gondii nucleic acid. Background technique [0002] Toxoplasma gondii is a globally distributed intracellular parasitic protozoan that infects almost all endothermic vertebrates, causing severe zoonotic diseases. About 1 / 4 of the world's population is infected with Toxoplasma gondii, and the average infection rate of the Chinese population is 7.9%. Pets such as dogs and cats are also very common to be infected with Toxoplasma gondii, which can cause abortion or cause no disease after infection and become a carrier of the pathogen. An important source of human infection with toxoplasmosis. In immunosuppressed, immunocompromised, and deficient patients, Toxoplasma infection is most commonly characterized by chorioretinitis in congenital infections and encephalitis in immunocompromised patients such as advanced AID...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/6893C12Q1/6844C12N15/11
CPCC12Q1/6844C12Q1/6893C12Q2521/513C12Q2522/101C12Q2563/107C12Q2521/101
Inventor 胡振新谭卓郜安国
Owner SUZHOU CLICKGENE BIOTECH CO LTD
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More