Novel glucose oxidase mutant
A glucose oxidase and mutant technology, applied in the field of new glucose oxidase mutants, can solve problems such as application limitations, increased equipment investment, poor thermal stability of glucose oxidase, etc., and achieve improved heat resistance, broad market prospects, and promising Benefits for a wide range of applications
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0056] Example 1 Obtainment of glucose oxidase heat-resistant single point mutant
[0057] 1.1 Amplification of the glucose oxidase gene
[0058] Aspergillus niger ( Aspergillus niger ) genome as a template for PCR amplification, PCR primers GOD-F1 and GOD-R1 are as follows:
[0059] GOD-F1: GGTATTGAGGCATCTTTGTTGAC
[0060] GOD-R1: TTATTGCATAGAAGCGTAATC
[0061] The PCR product was recovered by gel, connected to the pEASY-T vector, transformed into Escherichia coli DH5α, and the correct transformant was picked for sequencing. Sequencing results showed that the nucleotide sequence of the amplified gene fragment was SEQ ID NO: 2, and the encoded amino acid sequence was SEQ ID NO: 1. Through NCBI BLAST comparison, it was found that the sequence similarity between SEQ ID NO: 1 and the glucose oxidase from Aspergillus niger was as high as 100%, so it was confirmed that the gene obtained by PCR was the glucose oxidase gene and named GOD.
[0062] Amplification and Synthesis of ...
PUM
| Property | Measurement | Unit |
|---|---|---|
| Molecular weight | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
Login to View More 
