Novel glucose oxidase mutant

A glucose oxidase and mutant technology, applied in the field of new glucose oxidase mutants, can solve problems such as application limitations, increased equipment investment, poor thermal stability of glucose oxidase, etc., and achieve improved heat resistance, broad market prospects, and promising Benefits for a wide range of applications

Active Publication Date: 2018-06-05
QINGDAO VLAND BIOTECH GRP
View PDF4 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the thermal stability of glucose oxidase derived from Aspergillus niger is poor, and its aqueous solution is kept at 65°C for 5 minutes, and the remaining enzyme activity is less than 40%, which limits the application of this enzyme in pellet feed
At present, the method of spraying glucose oxidase liquid onto the feed after feed granulation not only increases equipment investment, but also cannot guarantee the stability of the enzyme preparation and the uniformity of the distribution of the enzyme preparation in the feed

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Novel glucose oxidase mutant

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0056] Example 1 Obtainment of glucose oxidase heat-resistant single point mutant

[0057] 1.1 Amplification of the glucose oxidase gene

[0058] Aspergillus niger ( Aspergillus niger ) genome as a template for PCR amplification, PCR primers GOD-F1 and GOD-R1 are as follows:

[0059] GOD-F1: GGTATTGAGGCATCTTTGTTGAC

[0060] GOD-R1: TTATTGCATAGAAGCGTAATC

[0061] The PCR product was recovered by gel, connected to the pEASY-T vector, transformed into Escherichia coli DH5α, and the correct transformant was picked for sequencing. Sequencing results showed that the nucleotide sequence of the amplified gene fragment was SEQ ID NO: 2, and the encoded amino acid sequence was SEQ ID NO: 1. Through NCBI BLAST comparison, it was found that the sequence similarity between SEQ ID NO: 1 and the glucose oxidase from Aspergillus niger was as high as 100%, so it was confirmed that the gene obtained by PCR was the glucose oxidase gene and named GOD.

[0062] Amplification and Synthesis of ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
Molecular weightaaaaaaaaaa
Login to View More

Abstract

The invention relates to the technical field of genetic engineering, and specifically provides a glucose oxidase mutant. According to the present invention, the heat resistance of the glucose oxidasesingle-point mutant is generally higher than the heat resistance of wild type glucose oxidase, the residual enzyme activity of the glucose oxidase single-point mutant is increased by 17.5-72.7% aftertreatment for 10 min at a temperature of 60 DEGC, and the residual enzyme activity of the glucose oxidase single-point mutant is increased by 23.8-100.4% after treatment for 5 min at a temperature of65 DEGC, such that the heat resistance of glucose oxidase is substantially improved due to the single-point mutation, the glucose oxidase single-point mutant can be well used as the feed additive compared to the wild type glucose oxidase, and the wide applications of glucose oxidase in feed can be easily achieved so as to provide wide market prospect.

Description

technical field [0001] The invention belongs to the technical field of genetic modification, and in particular relates to a novel mutant of glucose oxidase. Background technique [0002] Glucose oxidase is an aerobic dehydrogenase that specifically oxidizes β-D-glucose to generate gluconic acid and hydrogen peroxide. Glucose oxidase usually forms a redox system with catalase, oxidizes β-D-glucose in the presence of molecular oxygen to generate D-gluconolactone, and consumes oxygen to generate hydrogen peroxide. Catalase decomposes hydrogen peroxide to generate water and 1 / 2 oxygen, and then the water combines with gluconolactone to produce gluconic acid. Glucose oxidase shows strong specificity to β-D-glucopyranose. The hydroxyl group on glucose molecule C1 is crucial to the catalytic activity of the enzyme, and the hydroxyl group at the β position is 160 times higher than that at the α position. Glucose oxidase is completely inactive on L-glucose and 2-O-methyl-D-glucose....

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N9/04C12N15/53C12N15/81C12N1/19A23K20/189C12R1/84
CPCC12N9/0006C12Y101/03004
Inventor吴秀秀邵弨
OwnerQINGDAO VLAND BIOTECH GRP