Novel acrocalymma sp. QTY and application thereof in biological control

A technology based on endophytic fungi and vines, applied in the direction of microbial-based methods, chemicals for biological control, applications, etc., can solve the problem of narrow antibacterial spectrum

Active Publication Date: 2018-06-22
BAOJI UNIV OF ARTS & SCI
View PDF4 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

From the above reports, the obtained biocontrol endophytes are mainly concentrated in common bacterial species, and the antibacterial spectrum is relatively narrow, and the novel biocontrol endophytes with broad-spectrum antibacterial have not been reported yet.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Novel acrocalymma sp. QTY and application thereof in biological control
  • Novel acrocalymma sp. QTY and application thereof in biological control
  • Novel acrocalymma sp. QTY and application thereof in biological control

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0030] Example 1: Isolation and identification of the endophytic fungus QTY of Qingfengteng

[0031] The endophytic fungus of the Caulis chinensis with biological control potential is obtained by separating and purifying the medicinal plant Caulis chinensis on the Qinling Mountains in Baoji City, Shaanxi Province. The selected colonies were identified, and the bacterial species were identified by fungal ITS sequencing. Fungal genomic DNA was extracted using a fungal genome extraction kit. The fungal ITS universal primer was used to amplify the sequence. The general primers are: upstream primer: ITS1 (tccgtaggtgaacctgcgg), downstream primer: ITS4 (tcctccgcttattgatatgc). The total volume of the PCR amplification system is 35 μL: ultrapure water 26.3 μL, 10×PCR Buffer 3.5 μL, dNTP 0.7 μL, 10 μmol / L upstream primer ITS 11 μL, 10 μmol / L downstream primer ITS 41 μL, 5 U / μL Taq DNA Polymerase 0.5 μL. In addition, ultrapure water was used instead of template DNA for blank test. Th...

Embodiment 2

[0035] Example 2: Evaluation of the inhibitory activity of the endophytic fungus QTY of Qingfengteng to the pathogenic bacteria of apple anthracnose

[0036] The endophytic fungus Acrocalymma sp.QTY was fermented and cultured at 28°C and the shaker speed was 180rpm for 20 days. The fermentation medium was wort medium. The formula and production method were as follows: 20g of raw malt, boiled and then boiled for 20 minutes , filter to remove malt, add 20g of sucrose, 1g of peptone to the filtrate, add water to 1000mL; sterilize at 121°C for 30min after aliquoting. The fermented bacterial liquid was leached and extracted with ethyl acetate, the extraction volume ratio was 1:1, extracted three times, and the three upper layer extracts were combined and concentrated to obtain the crude ethyl acetate extract. The anti-phytopathogenic fungal activity of the crude extracts of endophytic fungi was evaluated by mycelium growth rate inhibition method. The method is as follows: Accurate...

Embodiment 3

[0039] Example 3: Evaluation of the inhibitory activity of the endophytic fungus QTY of Qingfengteng to the pathogenic bacteria of apple rot

[0040] The endophytic fungus Acrocalymma sp.QTY was fermented and cultured for 20 days at 25°C with a shaker speed of 150rpm. The fermentation medium was Cha's medium. The formula and production method were as follows: 30g of sucrose, 1g of yeast extract, 3g of sodium nitrate, Potassium chloride 0.5g, ferrous sulfate 0.01g, magnesium sulfate 0.5g, dipotassium hydrogen phosphate 1g, add water to 1000mL; after aliquoting, sterilize at 121°C for 30min. Extract the fermented bacterial liquid with ethyl acetate, the extraction volume ratio is 1:1, extract three times, combine the three upper layer extracts and concentrate to obtain the crude ethyl acetate extract, accurately weigh the thoroughly dried endophytic fungus acetic acid The crude extract of the ethyl ester phase is dissolved in acetone, mixed with PDA medium under aseptic conditio...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention discloses application of a strain of novel acrocalymma sp. QTY in the field of biological control. The acrocalymma sp. QTY is obtained by separating from Qinling medicinal plant-sinomenium acutum, and then purifying; the isogeny degree between the acrocalymma sp. QTY and acrocalymma cycadis of morosphaeriaceae is the highest and reaches 94%; the strain provided by the invention is anew strain and is name as acrocalymma sp. QTY. The acrocalymma sp. QTY, is preserved in China Center for Type Culture Collection (CCTCC) on January 25, 2018, and has a preservation number of CCTCC M 2018058. The acrocalymma sp. QTY has a very strong inhibitory effect on apple anthracnose pathogen, apple rot pathogen, wheat gibberellic disease pathogen, tomato gray mold pathogen, tomato early blight pathogen, rice blast pathogen and potato dry rot pathogen, and the relative inhibition rates of the plant pathogens are respectively 100%, 96%, 92%, 100%, 96%, 100% and 100%; therefore, the novel acrocalymma sp. QTY can be applied to the field of biological control and is used for preventing and controlling the plant diseases caused by the pathogens.

Description

technical field [0001] The invention belongs to the technical field of microorganisms, and in particular relates to the application of a novel Acrocalymma sp. QTY in the field of biological control, especially its application in the aspect of resisting plant diseases. Background technique [0002] Plant disease is one of the common disasters caused by plant pathogenic bacteria that affects the healthy development of agriculture, and its control techniques mainly include chemical control and biological control. Chemical control has gradually been replaced by biological control due to the problems of drug residues, environmental pollution and food safety. Biological control is a technical method that uses the microorganism itself or its secondary metabolites to inhibit the growth and reproduction of pathogenic microorganisms, thereby effectively preventing and controlling diseases. Due to its advantages of low cost and environmental friendliness, it conforms to the concept of...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Applications(China)
IPC IPC(8): C12N1/14A01N63/04A01P3/00C12R1/645
CPCA01N63/30C12N1/145C12R2001/645
Inventor 祖蕾肖健
Owner BAOJI UNIV OF ARTS & SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap