Novel acrocalymma sp. QTY and application thereof in biological control
A technology based on endophytic fungi and vines, applied in the direction of microbial-based methods, chemicals for biological control, applications, etc., can solve the problem of narrow antibacterial spectrum
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0030] Example 1: Isolation and identification of the endophytic fungus QTY of Qingfengteng
[0031] The endophytic fungus of the Caulis chinensis with biological control potential is obtained by separating and purifying the medicinal plant Caulis chinensis on the Qinling Mountains in Baoji City, Shaanxi Province. The selected colonies were identified, and the bacterial species were identified by fungal ITS sequencing. Fungal genomic DNA was extracted using a fungal genome extraction kit. The fungal ITS universal primer was used to amplify the sequence. The general primers are: upstream primer: ITS1 (tccgtaggtgaacctgcgg), downstream primer: ITS4 (tcctccgcttattgatatgc). The total volume of the PCR amplification system is 35 μL: ultrapure water 26.3 μL, 10×PCR Buffer 3.5 μL, dNTP 0.7 μL, 10 μmol / L upstream primer ITS 11 μL, 10 μmol / L downstream primer ITS 41 μL, 5 U / μL Taq DNA Polymerase 0.5 μL. In addition, ultrapure water was used instead of template DNA for blank test. Th...
Embodiment 2
[0035] Example 2: Evaluation of the inhibitory activity of the endophytic fungus QTY of Qingfengteng to the pathogenic bacteria of apple anthracnose
[0036] The endophytic fungus Acrocalymma sp.QTY was fermented and cultured at 28°C and the shaker speed was 180rpm for 20 days. The fermentation medium was wort medium. The formula and production method were as follows: 20g of raw malt, boiled and then boiled for 20 minutes , filter to remove malt, add 20g of sucrose, 1g of peptone to the filtrate, add water to 1000mL; sterilize at 121°C for 30min after aliquoting. The fermented bacterial liquid was leached and extracted with ethyl acetate, the extraction volume ratio was 1:1, extracted three times, and the three upper layer extracts were combined and concentrated to obtain the crude ethyl acetate extract. The anti-phytopathogenic fungal activity of the crude extracts of endophytic fungi was evaluated by mycelium growth rate inhibition method. The method is as follows: Accurate...
Embodiment 3
[0039] Example 3: Evaluation of the inhibitory activity of the endophytic fungus QTY of Qingfengteng to the pathogenic bacteria of apple rot
[0040] The endophytic fungus Acrocalymma sp.QTY was fermented and cultured for 20 days at 25°C with a shaker speed of 150rpm. The fermentation medium was Cha's medium. The formula and production method were as follows: 30g of sucrose, 1g of yeast extract, 3g of sodium nitrate, Potassium chloride 0.5g, ferrous sulfate 0.01g, magnesium sulfate 0.5g, dipotassium hydrogen phosphate 1g, add water to 1000mL; after aliquoting, sterilize at 121°C for 30min. Extract the fermented bacterial liquid with ethyl acetate, the extraction volume ratio is 1:1, extract three times, combine the three upper layer extracts and concentrate to obtain the crude ethyl acetate extract, accurately weigh the thoroughly dried endophytic fungus acetic acid The crude extract of the ethyl ester phase is dissolved in acetone, mixed with PDA medium under aseptic conditio...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


