Genes and proteins for prosthetic group-free chloroperoxidase CPO822 and application of genes and proteins

A technology of prosthetic chloroperoxide and prosthetic chloroperoxide is applied to the gene and protein of prosthetic chloroperoxidase CPO822 and its application fields, and can solve the problem of undetectable peroxidase and peroxidase. Catalase activity, narrow range of reaction substrates, etc., to achieve the effect of strong stability at high temperature and broad application prospects

Inactive Publication Date: 2018-07-06
NANYANG NORMAL UNIV
View PDF3 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Most haloperoxidases without prosthetic groups cannot detect peroxidase and catalase activities, and the reaction substrate range is narrow

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Genes and proteins for prosthetic group-free chloroperoxidase CPO822 and application of genes and proteins
  • Genes and proteins for prosthetic group-free chloroperoxidase CPO822 and application of genes and proteins
  • Genes and proteins for prosthetic group-free chloroperoxidase CPO822 and application of genes and proteins

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0048] Obtaining metagenomic DNA from soil samples:

[0049] The samples were collected from the surface soil of the oil field blowout in Nanyang City, Henan Province.

[0050] Take two 50mL centrifuge tubes, weigh the surface soil of the oil field, add 8g of each tube, add DNA extraction buffer 18mL (containing 100mM EDTA, 100mM sodium phosphate, 1.5M NaCl, 1% CTAB and 100mM Tris-Hcl, pH 8.0), vortex Rotate and shake to mix, shake at 220 rpm, treat at 37°C for 30 min, then add 2 mL of 20% SDS to each tube to make the final concentration 2% (w / v). Then put it in a water bath at 65°C for 2 hours, and gently invert it up and down several times every 15 minutes to mix well. Centrifuge at 6,000g at room temperature for 10min. After collecting the supernatant, transfer it to a clean centrifuge tube, add an equal volume of chloroform:isoamyl alcohol (24:1, V / V), and gently invert up and down to mix. Then centrifuge at 11,000g for 20min at 4°C to collect the supernatant, add 0.6 ti...

Embodiment 2

[0052] Construction of metagenomic library and DNA sequence acquisition of papermaking wastewater sediment:

[0053] 1. Construction and preservation of oilfield soil metagenomic library:

[0054] The oilfield soil metagenome DNA extracted in Example 1 was partially digested with Bam HI enzyme, and a 2.5-7.5 kb digested fragment was recovered by electrophoresis. The recovered DNA fragment was ligated with the pUC118 vector (Takara Company) that had been digested and dephosphorylated by Bam HI, transformed into E.coli DH5α competent cells by electric shock, and coated with 100 μg / mL ampicillin (Amp), 40 μg / mL X-gal and 0.5mM IPTG LB solid plate, thus constructing a metagene library with a storage capacity of 10,000 transformants and good diversity. Pick all white colony clones and inoculate them in a 384-well plate containing library medium for overnight culture on a 37°C culture shaker, and store at -80°C.

[0055] 2. Screening and sequence analysis of target genes:

[005...

Embodiment 3

[0059] Obtaining recombinant proteins expressed from DNA sequences:

[0060] 1. The positive clones obtained in Example 2 were inoculated in 5 mL of LB medium (100 μg / mL Amp), cultured on a shaker at 220 rpm at 37° C. overnight, and plasmids were extracted.

[0061] 2. Design primers CPOF and CPOR, respectively introduce EcoR I and Hind III restriction sites that can be inserted into the E. coli expression vector pet32a at both ends of the primers, and remove the stop codon.

[0062] The nucleotide sequence of primer CPOF (upstream primer) is shown in SEQ ID NO: 3: CCG GAA TTC ATGAAGACGTTGACAGTT;

[0063] The nucleotide sequence of primer CPOR (downstream primer) is shown in SEQ ID NO: 4: CCC AAG CTT TTAGGAGTTGATGAATTTGAGGATG;

[0064] 3. Using the extracted plasmid as a template, PCR amplification was performed using primers CPOF and CPOR.

[0065] The total volume of the PCR system is 30 μL, including 15 μL of Taq mix (Tiangen Company), 1 μL of each of the two prim...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
molecular weightaaaaaaaaaa
Login to View More

Abstract

The invention discloses genes and proteins for prosthetic group-free chloroperoxidase CPO822 with multiple functions, particularly capability of degrading benzopyrene and having activities of peroxidase, catalase, halogenase and esterase, and application of the genes and proteins. The invention has the beneficial effects that by virtue of a metagenome technology, a novel DNA sequence without functional study is obtained from soil metagenome; study results of the structures and functions of proteins coded by the DNA sequence show that a recombinant protein expressed by the DNA sequence has polyfunctionality, has a wider catalytic reaction range than existing separated peroxidase, can serve as a novel enzyme source to be applied to the fields such as washing, wastewater treatment, disinfection, lignin removal, production of epoxy derivatives, degradation of benzopyrene and the like, and has wide industrial application prospects. In addition, the study discovers that the enzyme is stableunder a wide-range pH value, is high in stability at a high temperature, and has great significances on wide popularization and application.

Description

technical field [0001] The invention relates to the technical field of enzymes, in particular to a gene, protein and application of a prosthetic group-free chloroperoxidase CPO822. Background technique [0002] Haloperoxidase is a typical representative of known multifunctional enzymes, which can catalyze highly enantioselective halooxidation, peroxidation, epoxidation and hydroxylation of organic compounds. According to the prosthetic group, halogenases can be divided into heme type, vanadium-dependent type, Fe 2+ There are four types of dependent and non-prosthetic groups. Among them, the most thoroughly studied and applied in industry is the heme-type chloroperoxidase (Chloroperoxidase CPO) derived from the marine fungus Caldariomyces fumago. Although the expression level of the enzyme is high, the enzyme has poor stability and is susceptible to irreversible inactivation due to the influence of various factors during operation, such as temperature, pH, hydrogen peroxide...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N9/08C12N15/53C12N15/70C12N1/21A62D3/02C12R1/19
CPCA62D3/02A62D2101/20C12N9/0065C12Y111/0101
Inventor董冰雪毛润乾张磊张伟夏敏李彩彩
OwnerNANYANG NORMAL UNIV