Unlock instant, AI-driven research and patent intelligence for your innovation.

Eucalyptus urophylla COMT (catechol-O-methyltransferase) gene and application thereof

A gene and urophyll technology, applied in Eucalyptus urophylla COMT gene and its application field, can solve the problems of inability to develop and achieve the effect of promoting the synthesis of G lignin monomer

Inactive Publication Date: 2018-07-31
GUANGXI FORESTRY RES INST
View PDF1 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Currently in Eucalyptus urophylla no COMT Once the genes are isolated and identified, it is even more impossible to use the gene sequences in them for genetic engineering regulation

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Eucalyptus urophylla COMT (catechol-O-methyltransferase) gene and application thereof
  • Eucalyptus urophylla COMT (catechol-O-methyltransferase) gene and application thereof
  • Eucalyptus urophylla COMT (catechol-O-methyltransferase) gene and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0021] Example 1: Eucalyptus urophylla COMT Gene cDNA sequence cloning

[0022] Reported in other plants searched by NCBI COMT Gene sequence, blast analysis gene conservative region, use Vector NTI software to design specific primers for the target gene COMT -F / COMT -R, the sequence is as follows:

[0023] COMT-F: GGAGAGGAGAGAATGGGTTC;

[0024] COMT-R: GAGCAGATCAAGCAGTCTTC.

[0025] The stem tissues of Eucalyptus urophylla GLU4 clone tissue-cultured seedlings transplanted and cultured for 3 to 4 weeks were extracted, and total RNA was extracted with RNA prep Pure Polysaccharide and Polyphenol Plant Total RNA Extraction Kit (TAKARA), and RNA LA PCR reverse transcription reagent was used to extract total RNA. The kit (TAKARA) was used to synthesize cDNA, all of which were operated according to the instructions of the kit, and the DNA samples were stored at -80°C.

[0026] Use cDNA as a template with target gene-specific primers COMT -F / COMT -R Use Ex-Taq polymerase (TA...

Embodiment 2

[0027] Embodiment 2, Eucalyptus urophylla COMT Gene sense expression vector construction

[0028] By using tool enzymes for digestion, target fragment recovery and ligation, the COMT Cloning into a plant expression vector such as pBI121 places the gene under the control of a promoter such as the CaMV 35S promoter.

[0029] Implement according to the following method of operation, and the detailed steps can be modified according to methods known to those skilled in the art:

[0030] Eucalyptus urophylla COMT Gene sequence design primers COMT -F1 / COMT -R1, both upstream and downstream primers are appended Xba I restriction site, the sequence is as follows.

[0031] COMT-F1: GGGTCTAGAGGAGAGGAGAGAATGGGTTC;

[0032] COMT-R1: GGGTCTAGAGAGCAGATCAAGCAGTCTTC.

[0033] Use the spin-column type common plasmid mini-extraction kit (Tiangen) to extract the COMT recombinant plasmid p COMT , with p COMT for the template, COMT -F1 / COMT -R1 is the primer, use Ex-Taq Enzyme (TA...

Embodiment 3

[0036] Embodiment 3: Utilize Eucalyptus urophylla COMT Gene regulation of tobacco lignin synthesis

[0037] Using conventional methods, the pBI121- COMT The recombinant vector was introduced into Agrobacterium LBA4404, and positive strains were obtained through antibiotic plate screening, PCR identification and sequencing identification. According to the conventional method, Agrobacterium bacterium liquid infects tobacco leaves, and after co-cultivation, differentiation, strong seedlings, rooting, transplanting and other stages of cultivation, transgenic tobacco seedlings are obtained.

[0038] Eight weeks after transplanting, the leaves of the seedlings were collected to extract the total DNA, and specific primers were used to COMT -F / COMT -R Perform PCR identification on the seedlings, and the plants corresponding to the samples that can successfully amplify a band of about 1100 bp can be determined as positive transgenic plants.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a eucalyptus urophylla COMT (catechol-O-methyltransferase) gene and application thereof. The nucleotide sequence of the eucalyptus urophylla COMT gene is as shown in SEQ ID NO.1. The gene can be applied to transgenic plants, and the gene is proven to have the effect of improving G lignin synthesis. The research on the functions of the eucalyptus urophylla COMT gene is favorable for promoting genetic engineering breeding for transgenic directional adjustment and control of lignin synthesis by eucalyptus urophylla.

Description

technical field [0001] The invention belongs to the technical field of plant genetic engineering, in particular to Eucalyptus urophylla COMT Genes and their applications. Background technique [0002] Eucalyptus is the general name of Eucalyptus in Myrtaceae, and its origin is Australia. Eucalyptus research in Guangxi is in a leading position in my country. The introduction of eucalyptus species began in the early 1970s. After years of introduction tests and cross-breeding, many excellent tree species, excellent provenances and excellent families have been obtained. Eucalyptus grows fast and has good materials. The area of ​​eucalyptus in Guangxi ranks first in the country, and it has become the main afforestation tree species of short-cycle raw material forest. Eucalyptus urophylla GLU4 clone ( Eucalyptus urophylla cloneGLU4) is a fine eucalyptus species widely planted in Guangxi, because its cellulose content, cellulose length and other pulping indicators are signific...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/54C12N9/10C12N15/82C12N1/21A01H5/00A01H6/82
Inventor 陈博雯刘海龙覃子海肖玉菲张烨张晓宁
Owner GUANGXI FORESTRY RES INST
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More