Eucalyptus urophylla COMT (catechol-O-methyltransferase) gene and application thereof
A gene and urophyll technology, applied in Eucalyptus urophylla COMT gene and its application field, can solve the problems of inability to develop and achieve the effect of promoting the synthesis of G lignin monomer
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0021] Example 1: Eucalyptus urophylla COMT Gene cDNA sequence cloning
[0022] Reported in other plants searched by NCBI COMT Gene sequence, blast analysis gene conservative region, use Vector NTI software to design specific primers for the target gene COMT -F / COMT -R, the sequence is as follows:
[0023] COMT-F: GGAGAGGAGAGAATGGGTTC;
[0024] COMT-R: GAGCAGATCAAGCAGTCTTC.
[0025] The stem tissues of Eucalyptus urophylla GLU4 clone tissue-cultured seedlings transplanted and cultured for 3 to 4 weeks were extracted, and total RNA was extracted with RNA prep Pure Polysaccharide and Polyphenol Plant Total RNA Extraction Kit (TAKARA), and RNA LA PCR reverse transcription reagent was used to extract total RNA. The kit (TAKARA) was used to synthesize cDNA, all of which were operated according to the instructions of the kit, and the DNA samples were stored at -80°C.
[0026] Use cDNA as a template with target gene-specific primers COMT -F / COMT -R Use Ex-Taq polymerase (TA...
Embodiment 2
[0027] Embodiment 2, Eucalyptus urophylla COMT Gene sense expression vector construction
[0028] By using tool enzymes for digestion, target fragment recovery and ligation, the COMT Cloning into a plant expression vector such as pBI121 places the gene under the control of a promoter such as the CaMV 35S promoter.
[0029] Implement according to the following method of operation, and the detailed steps can be modified according to methods known to those skilled in the art:
[0030] Eucalyptus urophylla COMT Gene sequence design primers COMT -F1 / COMT -R1, both upstream and downstream primers are appended Xba I restriction site, the sequence is as follows.
[0031] COMT-F1: GGGTCTAGAGGAGAGGAGAGAATGGGTTC;
[0032] COMT-R1: GGGTCTAGAGAGCAGATCAAGCAGTCTTC.
[0033] Use the spin-column type common plasmid mini-extraction kit (Tiangen) to extract the COMT recombinant plasmid p COMT , with p COMT for the template, COMT -F1 / COMT -R1 is the primer, use Ex-Taq Enzyme (TA...
Embodiment 3
[0036] Embodiment 3: Utilize Eucalyptus urophylla COMT Gene regulation of tobacco lignin synthesis
[0037] Using conventional methods, the pBI121- COMT The recombinant vector was introduced into Agrobacterium LBA4404, and positive strains were obtained through antibiotic plate screening, PCR identification and sequencing identification. According to the conventional method, Agrobacterium bacterium liquid infects tobacco leaves, and after co-cultivation, differentiation, strong seedlings, rooting, transplanting and other stages of cultivation, transgenic tobacco seedlings are obtained.
[0038] Eight weeks after transplanting, the leaves of the seedlings were collected to extract the total DNA, and specific primers were used to COMT -F / COMT -R Perform PCR identification on the seedlings, and the plants corresponding to the samples that can successfully amplify a band of about 1100 bp can be determined as positive transgenic plants.
PUM

Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com