Supercharge Your Innovation With Domain-Expert AI Agents!

CAPS molecular marker primer for detecting CMS (cytoplasmic male sterility) restoring genes of capsicum annuum and application of CAPS molecular marker primer

A technology for male sterility and gene restoration, which is applied in recombinant DNA technology, microbial determination/inspection, biochemical equipment and methods, etc. The effect of high accuracy

Inactive Publication Date: 2018-08-17
WUHAN ACADEMY OF AGRI SCI
View PDF5 Cites 12 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

According to previous studies, several molecular markers linked to the restorer gene Rf have been developed, such as CRF-SCAR (5.3cM), AFRF8CAPS (1.8cM), CaRf-FL-M2 (0.5cm), OP13-CAPS ( 1.1cM), OP13 1400 (0.37cM), PR-CAPS (1.8cM) and AF208834 (20.8cM) and other markers, they provide a theoretical basis for the classification and breeding of three pepper lines to a certain extent, but most of these molecular markers are based on AFLP, RAPD and SSR are directly or indirectly developed, and their polymorphism rate is lower than that of SNP markers, and the detection is more troublesome, and the effectiveness of detecting different pepper restorer genes needs to be verified

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • CAPS molecular marker primer for detecting CMS (cytoplasmic male sterility) restoring genes of capsicum annuum and application of CAPS molecular marker primer
  • CAPS molecular marker primer for detecting CMS (cytoplasmic male sterility) restoring genes of capsicum annuum and application of CAPS molecular marker primer
  • CAPS molecular marker primer for detecting CMS (cytoplasmic male sterility) restoring genes of capsicum annuum and application of CAPS molecular marker primer

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0025] Acquisition of CAPS molecular marker primers for pepper CMS male sterility restorer gene:

[0026] Download EST and cDNA sequences from the website databases PlantGDB (http: / / www.plantgdb.org) and NCBI (http: / / www.ncbi.nlm.nih.gov), using the Samtools tool (http: / / samtools.sourceforge .net) compare the above sequence to chromosome 6 of the pepper genome (http: / / peppersequence.genomics.cn / ), and perform SNP site query to find SNP markers that are close to the physical distance of the restorer gene Rf gene, using SNPsCAPs The program carried out enzyme cutting site conversion and primer design, and finally obtained M1 labeled primers 5'-GAAAGGATGCTGAACAGTTGC-3' and 5'-GCCCTACCAACTGTGCTTCT-3'. The upstream and downstream sequences of the M1 molecular marker are retrieved in the pepper genome sequence as follows:

[0027] >CAPS-M1

[0028] GAAAGGATGCTGAACAGTTGC AAAGAGTTTGTCAGAGTTGTTGAACTAGTTTGGTAAATGAAATAGAT A GATCT AGATTTTCATCTCCAAGATTATTAAAAATACAACTCAGTAATGTTCCTTTT...

Embodiment 2

[0031] The method for using the CAPS molecular marker primer of the capsicum CMS male sterility restoration gene comprises the following steps:

[0032] (A) Extracting the genomic DNA of the pepper to be tested: using the CTAB method to extract the genomic DNA of the pepper leaf, and diluting the genomic DNA into a 50 ng / μL working solution.

[0033] (B) PCR amplification:

[0034] a. Reaction system: 12 μL system: 6 μL 2×Taq PCR Master Mix, 4 μL ddH2O2 sterilized water, 0.5 μL upstream primer (concentration: 2.5 nM), 0.5 μL downstream primer (concentration: 2.5 nM), and 1 μL of the above-mentioned extracted Detect pepper gene DNA working solution;

[0035] The primers are: 5'-GAAAGGATGCTGAACAGTTGC-3' and 5'-GCCCTACCAACTGTGCTTCT-3'.

[0036] b. PCR amplification program: pre-denaturation at 94°C for 5 minutes; amplification cycle: 30 cycles of denaturation at 94°C for 30 sec, annealing at 58°C for 30 sec, and 30 sec at 72°C; final extension at 72°C for 5 min; and storage at ...

Embodiment 3

[0042] The application of the CAPS molecular marker primer of pepper CMS male sterility restorer gene:

[0043] Utilize the method described in embodiment 2 to carry out PCR, enzymatic digestion and electrophoresis detection to 112 parts of capsicum materials (numbered sequentially as No. 1-112, all unknown whether contain cytoplasmic male sterility restoration gene), partial detection results are as follows figure 1 as shown, figure 1 Middle M is DL2000Marker, lanes 1-36 are pepper materials 1-36, and samples 1, 2, 3, 4, 5, 6, 15, 16, 19, 20, 32, 33, 35, and 36 are all tested To a 243bp band pattern, which does not contain the pepper CMS cytoplasmic male sterility restorer gene; 7,10,11,12,14,21,22,23,24,25,26,27,28,29,30,34 Sample No. 172bp and 71bp were detected, which contained the cytoplasmic male sterility restorer gene and were homozygous restorer genotypes; samples 8, 9, 13, 17, 18, 31, and 34 contained 243bp and 172bp and a 71 bp triplet that contains a heterozygous...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to the field of biotechnology-assisted seed breeding, and particularly discloses a CAPS molecular marker primer for detecting CMS (cytoplasmic male sterility) restoring genes ofcapsicum annuum and application of the CAPS molecular marker primer. CAPS molecular markers are tightly linked with the CMS restoring genes of the capsicum annuum and are M1 markers. The CAPS molecular marker primer and the application have the advantages that detection can be facilitated by the CAPS molecular markers, stable and reliable results can be obtained, the CAPS molecular markers are co-dominant markers, and accordingly sterility restoring genes of capsicum annuum strains can be detected on a large scale only by means of simple conventional experiment operation such as hereditary substance extraction, PCR (polymerase chain reaction), restriction incision enzyme digestion and routine agarose electrophoresis; the selective breeding ranges of restoring line materials for the capsicum annuum can be expanded by development and application of the CAPS molecular markers, the seed breeding efficiency can be improved, seed breeding progresses can be accelerated, and the CAPS molecularmarker primer and the application have important significance in molecular marker-assisted seed breeding for CMS three-line matched seed production and restoring line materials for the capsicum annuum.

Description

technical field [0001] The invention relates to the field of biotechnology-assisted breeding, in particular to a CAPS molecular marker primer for detecting the CMS male sterility restoration gene of pepper and its application. Background technique [0002] Pepper (Capsicum annuum L.) is an annual or limited perennial herbaceous plant of Solanaceae and Capsicum genus, native to Central and Latin America, and widely planted all over the world. In terms of production, pepper has significant heterosis, and the use of cytoplasmic male sterility (CMS) in pepper can be used for three-line matching cultivation. The hybrids prepared can better solve the problem of incomplete anther emasculation in production, ensuring hybridization. Seed purity reduces the risk of pepper seed production, and at the same time helps to protect the intellectual property rights of varieties. The pepper restorer gene is the basis for the utilization of heterosis in pepper, and the key is to breed restore...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/6895C12N15/11
CPCC12Q1/6895C12Q2600/13C12Q2600/156
Inventor 张洪源张敏黄树苹谈杰陈霞谈太明
Owner WUHAN ACADEMY OF AGRI SCI
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More