CAPS molecular marker primer for detecting CMS (cytoplasmic male sterility) restoring genes of capsicum annuum and application of CAPS molecular marker primer
A technology for male sterility and gene restoration, which is applied in recombinant DNA technology, microbial determination/inspection, biochemical equipment and methods, etc. The effect of high accuracy
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0025] Acquisition of CAPS molecular marker primers for pepper CMS male sterility restorer gene:
[0026] Download EST and cDNA sequences from the website databases PlantGDB (http: / / www.plantgdb.org) and NCBI (http: / / www.ncbi.nlm.nih.gov), using the Samtools tool (http: / / samtools.sourceforge .net) compare the above sequence to chromosome 6 of the pepper genome (http: / / peppersequence.genomics.cn / ), and perform SNP site query to find SNP markers that are close to the physical distance of the restorer gene Rf gene, using SNPsCAPs The program carried out enzyme cutting site conversion and primer design, and finally obtained M1 labeled primers 5'-GAAAGGATGCTGAACAGTTGC-3' and 5'-GCCCTACCAACTGTGCTTCT-3'. The upstream and downstream sequences of the M1 molecular marker are retrieved in the pepper genome sequence as follows:
[0027] >CAPS-M1
[0028] GAAAGGATGCTGAACAGTTGC AAAGAGTTTGTCAGAGTTGTTGAACTAGTTTGGTAAATGAAATAGAT A GATCT AGATTTTCATCTCCAAGATTATTAAAAATACAACTCAGTAATGTTCCTTTT...
Embodiment 2
[0031] The method for using the CAPS molecular marker primer of the capsicum CMS male sterility restoration gene comprises the following steps:
[0032] (A) Extracting the genomic DNA of the pepper to be tested: using the CTAB method to extract the genomic DNA of the pepper leaf, and diluting the genomic DNA into a 50 ng / μL working solution.
[0033] (B) PCR amplification:
[0034] a. Reaction system: 12 μL system: 6 μL 2×Taq PCR Master Mix, 4 μL ddH2O2 sterilized water, 0.5 μL upstream primer (concentration: 2.5 nM), 0.5 μL downstream primer (concentration: 2.5 nM), and 1 μL of the above-mentioned extracted Detect pepper gene DNA working solution;
[0035] The primers are: 5'-GAAAGGATGCTGAACAGTTGC-3' and 5'-GCCCTACCAACTGTGCTTCT-3'.
[0036] b. PCR amplification program: pre-denaturation at 94°C for 5 minutes; amplification cycle: 30 cycles of denaturation at 94°C for 30 sec, annealing at 58°C for 30 sec, and 30 sec at 72°C; final extension at 72°C for 5 min; and storage at ...
Embodiment 3
[0042] The application of the CAPS molecular marker primer of pepper CMS male sterility restorer gene:
[0043] Utilize the method described in embodiment 2 to carry out PCR, enzymatic digestion and electrophoresis detection to 112 parts of capsicum materials (numbered sequentially as No. 1-112, all unknown whether contain cytoplasmic male sterility restoration gene), partial detection results are as follows figure 1 as shown, figure 1 Middle M is DL2000Marker, lanes 1-36 are pepper materials 1-36, and samples 1, 2, 3, 4, 5, 6, 15, 16, 19, 20, 32, 33, 35, and 36 are all tested To a 243bp band pattern, which does not contain the pepper CMS cytoplasmic male sterility restorer gene; 7,10,11,12,14,21,22,23,24,25,26,27,28,29,30,34 Sample No. 172bp and 71bp were detected, which contained the cytoplasmic male sterility restorer gene and were homozygous restorer genotypes; samples 8, 9, 13, 17, 18, 31, and 34 contained 243bp and 172bp and a 71 bp triplet that contains a heterozygous...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap