A kind of method for preparing genetic engineering subunit vaccine of Clostridium ovary
A subunit vaccine and vaccine technology, applied in the field of biomedicine, can solve the problems of protein immunogenicity reduction and achieve the effects of avoiding toxicity, ensuring immunogenicity, and ensuring safety
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0047] 1. Cloning and fusion expression vector construction of CPB toxin, CSA toxin, ETX106 toxin and CPA toxin
[0048] CPB toxin cloning and fusion expression vector construction:
[0049] Using the INVASIN-CPB sequence synthesized from the original gene as a template, the following primers were designed:
[0050] F-histev-ICPB: GG GGATCC gagaacctatacttccaagga acagccaaaagcaaaaagttttccgag
[0051] ICPB-R: GG GTCGAC aatagctgttactttgtgagtaag
[0052] The underlined part indicates the BamHI and Sal I restriction sites, the bold and italic parts are the tev restriction site sequences, and the CPB gene sequence and fusion adjuvant sequence were cloned into the pVEXK-HN-MBP-MCS-K6EE-his vector , the recombinant expression plasmid was determined by enzyme digestion and sequencing, and named as pVEXK-HN-fMBP-TEV-INVASIN-CPB-K6EE-HIS;
[0053] 2. CSA toxin cloning and fusion expression vector construction
[0054] Using the flagellin-CSA sequence synthesized from the origina...
Embodiment 2
[0066] Example 2: Expression and purification of four fusion toxin proteins
[0067]The pPVEXK-HN-fMBP-TEV-flagellin-CPA-K6EE-HIS plasmids were transformed into cBL21(DE3) competent cells to obtain genetically engineered strains cBL21(DE3) / pVEXK-HN-fMBP-TEV-flagellin-CPA-K6EE- HIS, the pVEXK-HN-fMBP-TEV-INVASIN-CPB-K6EE-HIS plasmid was transformed into cBL21(DE3) competent, and the genetically engineered strain cBL21(DE3) / pVEXK-HN-fMBP-TEV-INVASIN-CPB- K6EE-HIS, the pVEXK-HN-fMBP-TEV-flagellin-CSA-K6EE-HIS plasmid was transformed into cBL21(DE3) competent to obtain genetically engineered strain cBL21(DE3) / pVEXK-HN-fMBP-TEV-flagellin-CSA -K6EE-HIS, the pVEXK-HN-fMBP-TEV-PADRE-ETX106-K6EE-HIS plasmid was transformed into cBL21(DE3) competent to obtain genetically engineered strain cBL21(DE3) / PVEXK-HN-fMBP-TEV-PADRE- ETX106-K6EE-HIS.
[0068] The four strains identified by pre-expression were transferred to a large Erlenmeyer flask (capacity 2000ml) of 400ml LB (containing a fi...
Embodiment 3
[0069] Example 3: Post-purification process of four fusion toxin proteins
[0070] Add Triton X-114 with a final concentration of 1% to the protein purification solution, stir and mix for 60 min at 4 °C to make it fully mixed, then place it in a water bath at 30 °C for 40 min, stirring occasionally, and then centrifuge at 14,000 g at 25 °C for 15 min , carefully remove the upper aqueous phase. The upper aqueous phase was then added with Triton X-114 to extract and remove endotoxin, and the test was carried out for two cycles; after that, the protein sample was filtered and sterilized with a 0.22um filter, and the endotoxin content was detected by Limulus reagent, and a sterility test was performed to make each protein sample. The endotoxin content of the recombinant protein is less than 10000EU / ml, and the sterility test is qualified;
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More