Preparation method and application of bacilli for efficiently metabolizing glycerol

A Bacillus and Bacillus licheniformis technology, applied in the fields of genetic engineering and microorganisms, can solve the problems of slow glycerol metabolism and achieve the effect of increasing yield

Active Publication Date: 2018-09-28
HUBEI UNIV
View PDF3 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Glycerol is a carbon source that is not transported by PTS. So far, there has been no report on the relationship between the transcriptional repressor CcpC and glycerol metabolism. Therefore, it is not clear whether the expression level of CcpC will affect the metabolism of glycerol. Many Bacillus species have been reported, including Bacillus subtilis, Bacillus licheniformis, and Bacillus amyloliquefaciens can all metabolize glycerol. However, the rate of glycerol metabolism of these strains is relatively slow, and it is necessary to further improve the metabolic capacity of glycerol and accelerate the conversion level of glycerol, so as to realize the efficient synthesis of useful crude glycerol from cheap crude glycerol. chemical of value

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Preparation method and application of bacilli for efficiently metabolizing glycerol
  • Preparation method and application of bacilli for efficiently metabolizing glycerol
  • Preparation method and application of bacilli for efficiently metabolizing glycerol

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0024] Construction of Bacillus licheniformis ccpC Knockout Vector

[0025] Step 1: According to the upstream and downstream sequences of the ccpC gene (shown in SEQ ID NO.1) in the Bacillus licheniformis WX-02 genome DNA sequence, design the upstream homology arm primers (A-F and A-R) and the downstream homology of the ccpC gene Arm primers (B-F and B-R); and using the genomic DNA of Bacillus licheniformis WX-02 as a template, carry out PCR amplification with the upstream homology arm primers and downstream homology arm primers of the ccpC gene respectively to obtain the upstream homology arms of the ccpC gene (833bp) and the downstream homology arm of the ccpC gene (885bp);

[0026] Among them, the sequence of A-F, A-R, B-F, B-R is:

[0027] A-F: GCTCTAGAAAATGTGGATAGCCTGAC,

[0028] A-R: GAGTCCTGCCTTTTCTAGTGTGGACATTCCTCATTCCAATAAGT,

[0029] B-F: ACTTATTGGAATGAGGAATGTCCACACTAGAAAGGCAGGACTC,

[0030] B-R: TGCGAGCTCCAAAGCCGTCCGTTTCTCC;

[0031] Step 2: Link the upstream h...

Embodiment 2

[0037] Construction of ccpC knockout strain:

[0038]Step 1: Transform the integrated expression vector T2(2)-ccpC into Bacillus licheniformis WX-02, screen under the condition of 37°C in a culture medium containing kanapenicillin resistance, and obtain transformants by screening, and transformants Pick the plasmid for colony PCR verification (the primers used are: T2-F and T2-R). If the PCR verification result of the transformant is: an electrophoresis band occurs at 1918bp, it proves that the integrated expression vector T2(2)-ccpC is successfully transferred into Bacillus licheniformis WX-02, at this time, the transformant is a positive transformant ( That is, the Bacillus licheniformis WX-02 transformed into the integrated expression vector T2(2)-ccpC);

[0039] Step 2: Transplant the positive transformants obtained in step 1 at 45°C on a medium containing kanapenicillin resistance for 3 times, each time for 12 hours, and use T2-F and ccpC-YR as primers Single-crossover ...

Embodiment 3

[0045] Efficient metabolism of glycerol by Bacillus licheniformis WX-02ΔccpC:

[0046] 1) Seed fermentation: activate Bacillus licheniformis WX-02 and Bacillus licheniformis WX-02ΔccpC on the plate, pick the bacteria and inoculate them into 250mL Erlenmeyer flasks containing 50mL liquid LB respectively, and culture at 37°C and 180rpm for 10h. Then subsequently inoculate in the fermentation medium with an inoculum size of 1% (volume ratio);

[0047] The applicant selected two culture medium formulations for the fermentation medium, the number 1-9 is the basic medium, and the number 10-18 is the poly-γ-glutamic acid fermentation medium (Table 1).

[0048] The culture condition of the basic medium is 37° C., 180 rpm for 24 hours.

[0049] The culture condition of the poly-γ-glutamic acid fermentation medium was 37° C., 180 rpm for 48 hours, and the concentration of glycerol was measured after the fermentation.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the technical field of genetic engineering and microorganism, and particularly relates to a preparation method and application of bacilli for efficiently metabolizing glycerol. According to the method, a molecular biology technology is used; a transcription inhibition factor gene ccpC is knocked out in bacillus licheniformis to obtain a bacillus licheniformis engineering strain WX-02 delta ccpC with the ccpC being deleted, and the glycerol metabolizing speed of the bacillus licheniformis is obviously improved. The glycerol consumption speed of the WX-02 delta ccpC in different culture mediums is at least improved by 18.38 percent through being compared with that of an original bacterium of the bacillus licheniformis; the improvement value can reach 32.67 percent tothe highest degree. When the strain is used in a poly gamma-glutamic acid fermentation culture medium, the yield of the poly gamma-glutamic acid can be obviously improved and is at least improved by10.7 percent; the improvement value can reach 17.4 percent to the highest degree. The result shows that the genetic engineering transformation method has important effect on improving the glycerol metabolizing effect; the efficiency of synthesizing bio-based chemicals by the glycerol is improved.

Description

technical field [0001] The invention belongs to the technical fields of genetic engineering and microbes, and in particular relates to a preparation method and application of a bacillus capable of efficiently metabolizing glycerol. Background technique [0002] Glycerol is the main by-product of biodiesel production and processing. About 1 ton of crude glycerol is produced for every 10 tons of biodiesel produced. At present, the biodiesel processing industry produces a large amount of crude glycerin, which makes the price of crude glycerin extremely low, resulting in unsalable crude glycerol and reducing the Biodiesel corporate profits. Therefore, glycerol as a carbon source for fermentation has more reducing power, and with the same mass of glycerol and glucose, glycerol can produce more biological compounds. There have been many reports using glycerol as a carbon source to ferment and synthesize various bio-based chemicals, such as ethanol, lactic acid, succinic acid, cit...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/75C12N15/90C12N15/31C12P13/02C12R1/10
CPCC07K14/32C12N15/75C12N15/902C12P13/02
Inventor陈守文占杨杨王欢周梦林许勇石姣马昕李鑫
OwnerHUBEI UNIV