Polysaccharogenic metastase MDOH gene and its application

A technology of glucosyltransferase and glycosyltransferase, applied in the direction of transferase, application, genetic engineering, etc., can solve the problems of little research and unclear relationship between the pathogenicity of bacteria with specific functions

Active Publication Date: 2020-12-04
GUANGXI UNIV
View PDF1 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

There are few studies on glucan synthesis-related genes in Xanthomonas, and the specific function and relationship with bacterial pathogenicity are still unclear

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Polysaccharogenic metastase MDOH gene and its application
  • Polysaccharogenic metastase MDOH gene and its application
  • Polysaccharogenic metastase MDOH gene and its application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0024] Example 1 Construction of MdoH gene (glucosyltransferase gene) deletion mutant

[0025] The Escherichia coli with the recombinant plasmid pKDMdoH obtained by integrating the upstream and downstream 200bp fragments of the MdoH gene into the pK18mobsacB plasmid was cultured overnight, the recombinant plasmid was extracted, and the electroporation competence of XooK74 was prepared, and the recombinant plasmid pKDMdoH was transferred into Xanthomonas XooK74 by electroporation In , with the help of homologous single exchange, the plasmid pKDMdoH can be integrated into the genome of XooK74, screened with Kan, Sm resistance plates, and further confirmed by simultaneous parallel spotting on sucrose plates containing Sm and Kan, Sm resistance plates single swap. Transfer the confirmed single exchangers to OB medium containing Sm, culture on a shaker at 28°C for 24 hours, and spread them on OA plates containing Sm and 10% sucrose for 3-4 days. During this process, Homologous sin...

Embodiment 2

[0026] Cloning and sequence determination of embodiment 2 MdoH gene

[0027] According to the gene sequence of MdoH, primers (AAAGGATCCGAGAACTTGTGCATCGAA (SEQ.ID.NO.3) and TTTAAGCTTCCGGTGCGAACTCAGATC (SEQ.ID.NO.4)) were designed, and the total DNA of Xanthomonas spp. Amplify the full-length sequence of the gene (95°C 10min; 95°C 30sec; 60°C 30sec; 72°C 180sec, 35 cycles; 72°C 5min) ( figure 1 ), and clone it into the cloning vector pK18mobsacB, and use the dideoxynucleotide method to determine the DNA nucleotide sequence on the ABI377 DNA automatic sequencer. The correct ModH gene sequence verified by sequencing was cloned into the prokaryotic expression vector pLAFRJ, and the recombinant plasmid pJMdoH containing the gene was obtained. source fragment ( figure 1 ).

Embodiment 3

[0028] Example 3 Verification of MdoH gene deletion mutants

[0029] Perform PCR verification on the deletion mutant DMModH, extract the total DNA of DMModH as a template, and pair with the external specific primer CMF / R (AAAGGATCCCGTCACTGCAACCGATTG (SEQ.ID.N0.5) and TTTAAGCTTTCGACCTGAGCCACCGAT (SEQ.ID.N0.6)) of the ModH gene Perform PCR verification (95°C 5min; 95°C 30sec; 60°C 30sec; 72°C 120sec, 30 cycles; 72°C 5min), the expected size of the product is 930bp, wild-type K74 total DNA template is used as a control, and the same primer is used conditions as a control, the expected size of the product is 2700bp ( figure 2 ). Using the total DNA of mutant DMModH and wild-type K74 as templates, PCR verification was carried out with specific primers IMF / R (ATCGTGCGGCTGGTCGCCGG (SEQ.ID.N0.7) and TTCTTCGTAGCTGCCCTGCA (SEQ.ID.N0.8)) within the ModH gene (95°C 5min; 95°C 30sec; 60°C 30sec; 72°C 30sec, 30 cycles; 72°C 5min), DMModH is not expected to produce a band, K74 expected pr...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
molecular weightaaaaaaaaaa
Login to View More

Abstract

The invention discloses a gene, namely a glucan glucosyltransferase gene MdoH, relates to xanthomonas pathopoiesis of rice bacterial leaf blight. The gene MdoH has a base sequence of SEQ ID. NO.1 in asequence table, and is composed of 1836 bases. The gene MdoH is one member of a glucan synthetic gene cluster. The protein coded by the gene contains 611 amino acids, and is noted as glucosyltransferase. Researches prove that, the pathogen virulence is reduced due to the function loss of the gene, and the gene can serve as a drug target to be used for researching and developing bio-pesticides forcontrolling the rice bacterial leaf blight. Therefore, the gene has an important application potential in control of rice diseases. The gene related to the pathopoiesis of rice bacterial leaf blighthas significances and values for deeply understanding the pathogenesis of pathogenic bacteria in rice, establishing a pathogenic model of the rice and pathogenic bacteria, and providing the drug control target and drug development platform.

Description

technical field [0001] The invention belongs to glucan synthesis-related genes of rice bacterial blight pathogenic bacteria, in particular to a glucan glucosyltransferase MdoH gene and application thereof. Background technique [0002] Rice bacterial blight is a bacterial disease. The pathogenic bacteria belong to the genus Xanthomonas, which was named Xanthomonas.oryzae pv.oryzae (Xoo for short) in 1990. The rice bacterial blight pathogen is a Gram-negative bacillus with flagella, no spores and capsules, but secretes exopolysaccharides. Rice bacterial blight bacteria invade rice leaves through water holes, gradually extending downward from the leaf tip, and produce a small amount of pus. All stages of rice growth can be infected with Xanthomonas oryzae, and the infected parts are mainly leaves and some are leaf sheaths. The specific characteristics of rice bacterial blight are also slightly different due to differences in rice varieties, disease-infected periods, and clim...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): C12N15/54C12N9/10C12N15/70C12N1/21C12R1/19
CPCC12N9/1051C12N15/70
Inventor黄胜倪哲林茵吴德波
OwnerGUANGXI UNIV