Unlock instant, AI-driven research and patent intelligence for your innovation.

An ELISA kit for detecting goose Astrovirus antibody and its preparation method

A technology of astroviruses and kits, applied in the fields of biotechnology and animal infectious disease diagnosis and research, can solve problems such as difficult popularization and application, and achieve the effects of fast methods, high sensitivity, and easy operation

Active Publication Date: 2021-04-06
YANGZHOU UNIV
View PDF7 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0003] The diagnosis of the disease is mainly through RT-PCR with degenerate primers for the detection of avian astrovirus, and the amplified nucleic acid fragment must be sequenced to determine whether it is the goose astrovirus that causes goose gout; our laboratory recently used isolated goose astrovirus Astrovirus (avian Astrovirus type 3) infects susceptible cells. After the virus replicates, the cells are fixed, and the indirect immunofluorescence test is used to detect whether the serum to be tested contains antibodies to the virus. Due to limited conditions, these two methods are difficult to be widely used at the grassroots level. Promote application
Since the virus is a newly discovered goose astrovirus, other serological diagnostic methods have not been reported. Therefore, it is important to establish a goose astrovirus antibody detection method with strong specificity, high sensitivity, simple operation and low cost. significance

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • An ELISA kit for detecting goose Astrovirus antibody and its preparation method
  • An ELISA kit for detecting goose Astrovirus antibody and its preparation method

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0036] Example 1 Preparation of Goose Astrovirus (Avian Astrovirus Type 3) Recombinant Protein

[0037] 1. Artificial synthesis of the Cap P2 gene: According to the results of the whole genome sequencing of the GAstV GD strain in our laboratory, the codon of the Cap P2 gene was optimized to make it suitable for expression in E. coli, and restriction enzyme sites were introduced at both ends EcoRV and XhoI, the gene was synthesized by Shanghai Sangon Bioengineering Co., Ltd., the sequence is as follows:

[0038] 5’-GATATCCAGGTTACACCCTCGCTTGTGTACAACTTCCAGGGTGAAAGGCAGAGCACTACAGAATCGTGCTCATTCCTGGTGTTTGGAATACCACAGGCAGAATCCAGGTCAAGATACAATGCAGCTATAACCTTCAATGTTGGCTACCGTGGAAGGACTTCAACATCATTTACACTTGGAACACACAATTGGTGGGCTGTTATGACACTTTCACAAACAGGAGTAATTTTTGCACCACCGGCTGTGGGCACAGGGGTCTGTAATACATTGGCTACAGCCATACAACATTTAAATCCTGAGCTTGAAACAGCAGTCCTGCGTGTGAATACCAGTACAACATCTACTGGTGGGCTAATAACGGAACTCAGGAATCGGCTCAACATCGCTGATGGGGACTATGTGATTTCAATGGGTGATCCGCAAGGAAATAGGTCAGCACTGTACTTTAGGAATTCAGACCAGAAATGGGTGT...

Embodiment 2

[0041] The preparation of embodiment 2 positive control serum, negative control

[0042] Adjust the concentration of the purified Cap P2 recombinant protein to 1 mg / mL with 0.01M PBS (pH7.4), mix it with an equal volume of Freund’s complete adjuvant (Sigma Company), and fully emulsify it with a sonicator (Bandelin Company) (power 30W, 5min); the emulsified recombinant antigen was intramuscularly injected into 10 60-day-old healthy goslings (provided by the National Waterfowl Gene Bank of Jiangsu Agriculture and Animal Husbandry Technology Vocational College), 0.5mL / ; 10 days after the first immunization, Freund's incomplete adjuvant 10 days later, the same dose of recombinant antigen was used to boost immunization once; on the 7th day after the third immunization, goose blood was collected aseptically to separate serum; according to the conventional indirect ELISA method, respectively 2.5 μg / mL Cap P2 protein was recombined to coat the microtiter plate, and after blocking, it ...

Embodiment 3

[0043] Embodiment 3 detects the preparation of goose Astrovirus antibody ELISA kit

[0044] 1. Antibody detection ELISA plate: The kit contains 4 treated 96-well ELISA plates (packed in aluminum foil bags). The ELISA plate treatment process is as follows: Dilute Cap with 0.05M carbonate buffer (pH9.6). P2 recombinant protein to a final concentration of 2.5 μg / mL, add 100 μL to each well of the odd-numbered vertical row of the 96-well plate (sample detection well), add no diluted antigen to each well of the even-numbered vertical row of the 96-well plate (background control well), and statically at 4°C. Set aside for 24 hours, wash twice with washing solution PBST (0.01M PBS, 0.5‰Tween-20, 0.01% Proclin300, pH7.4), add blocking solution (PBST, 5% skimmed milk powder, pH7.6) to each well at 37°C Seal for 2 hours, then wash twice with washing solution PBST, pat off residual water on absorbent paper, air-dry in an ultra-clean workbench, put into an aluminum foil bag (1 microplate / ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to an ELISA kit for detecting goose astrovirus antibody and a preparation method thereof, comprising an enzyme-labeled plate, an enzyme-labeled secondary antibody, a goose astrovirus positive control serum, a goose astrovirus negative control serum, a diluent, and a 10× Washing solution, TMB substrate solution, and stop solution; the antigen coated on the microtiter plate in the kit is the Cap protein of goose Astrovirus; the goose Astrovirus is avian Astrovirus type 3. The present invention expresses and purifies newly occurring Goose Astrovirus (Avian Astrovirus Type 3) Cap protein as the coating antigen, uses the indirect ELISA method to detect the goose serum sample to be tested, and assembles it for the determination of the Astrovirus antibody in the serum kit. The kit can be used for serological diagnosis of recent goose astrovirus infection, monitoring of antibody levels, epidemiological investigation, etc., and provides a simple and quick method for the prevention and control of goose astrovirus.

Description

technical field [0001] The present invention relates to the research field of biotechnology and animal infectious disease diagnosis, be specifically related to a kind of ELISA kit and the preparation method of test kit that detect goose Astrovirus (being avian Astrovirus type 3) antibody, be used for goose Astrovirus ( Serological diagnosis of avian Astrovirus type 3) infection, monitoring of antibody levels, epidemiological investigation, etc. Background technique [0002] Since 2015, goose infectious disease with goose goose as the main symptom has occurred in some provinces in China. It began to spread in 2016. In 2017, the disease basically occurred in all goose-raising provinces across the country. The onset goose is about 1 week old, and the course of the disease lasts 7-10 days. Today, the morbidity rate is as high as 80-90%, and the mortality rate is 20-70%. The anatomical lesions are mainly manifested as a large amount of urate deposition in the liver, heart, gizza...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): G01N33/569G01N33/558G01N33/535
CPCG01N33/535G01N33/558G01N33/56983
Inventor 张鑫宇刘潇羽周花艳孙怀昌叶建强
Owner YANGZHOU UNIV
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More